Incidental Mutation 'R5916:Ocln'
ID 461357
Institutional Source Beutler Lab
Gene Symbol Ocln
Ensembl Gene ENSMUSG00000021638
Gene Name occludin
Synonyms Ocl
MMRRC Submission 044113-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.664) question?
Stock # R5916 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100633015-100689226 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 100642687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 216 (D216A)
Ref Sequence ENSEMBL: ENSMUSP00000125642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022140] [ENSMUST00000069756] [ENSMUST00000159459] [ENSMUST00000160859]
AlphaFold Q61146
Predicted Effect probably benign
Transcript: ENSMUST00000022140
AA Change: D465A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022140
Gene: ENSMUSG00000021638
AA Change: D465A

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069756
AA Change: D465A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065284
Gene: ENSMUSG00000021638
AA Change: D465A

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 3.3e-29 PFAM
Pfam:Occludin_ELL 419 518 3.8e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159459
AA Change: D216A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125642
Gene: ENSMUSG00000021638
AA Change: D216A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Occludin_ELL 170 269 6.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160859
AA Change: D465A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124849
Gene: ENSMUSG00000021638
AA Change: D465A

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous null mice display gastritis, loss of gastric parietal and chief cells, gastric mucus cell hyperplasia, reduced gastric acid secretion, growth retardation, male infertility, seminiferous tubule atrophy, failure to nurse pups, mineral deposits in the brain, and thinning of the compact bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,349,550 (GRCm39) N269I possibly damaging Het
Abcc1 G T 16: 14,283,006 (GRCm39) V1161F possibly damaging Het
Adam3 A T 8: 25,174,555 (GRCm39) probably null Het
Agt A T 8: 125,290,597 (GRCm39) S237T possibly damaging Het
Ano3 A T 2: 110,512,181 (GRCm39) F674L probably benign Het
Asb2 G T 12: 103,290,135 (GRCm39) A504E probably damaging Het
Atp13a1 T A 8: 70,259,748 (GRCm39) I1113N probably damaging Het
Atxn7l2 T C 3: 108,112,978 (GRCm39) probably null Het
Bambi A G 18: 3,511,463 (GRCm39) T95A probably benign Het
Cfap210 A T 2: 69,619,806 (GRCm39) M1K probably null Het
Clrn1 T C 3: 58,753,783 (GRCm39) T193A probably benign Het
Colgalt2 T A 1: 152,379,873 (GRCm39) D437E probably damaging Het
Dchs1 C A 7: 105,408,373 (GRCm39) A1820S probably damaging Het
Dnah12 T A 14: 26,428,073 (GRCm39) I233N possibly damaging Het
Dsc3 T C 18: 20,120,077 (GRCm39) N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 (GRCm39) probably null Het
Erich3 A T 3: 154,401,460 (GRCm39) R36S probably damaging Het
Fam243 T A 16: 92,117,559 (GRCm39) E243V probably damaging Het
Fmnl3 A T 15: 99,219,709 (GRCm39) C680S probably damaging Het
Focad T C 4: 88,275,778 (GRCm39) L1129P unknown Het
Fzd3 G A 14: 65,440,178 (GRCm39) T664I probably benign Het
Glb1l3 T C 9: 26,766,032 (GRCm39) I129V probably benign Het
Heatr1 T C 13: 12,449,352 (GRCm39) F1950S probably damaging Het
Herc6 G A 6: 57,623,188 (GRCm39) G597E probably benign Het
Hmcn2 T A 2: 31,286,151 (GRCm39) V2101D probably damaging Het
Il17re T A 6: 113,447,084 (GRCm39) C612S probably damaging Het
Il36g T G 2: 24,082,806 (GRCm39) *194E probably null Het
Junb T C 8: 85,704,505 (GRCm39) Y185C probably benign Het
Lrriq1 G A 10: 103,057,243 (GRCm39) Q186* probably null Het
Lrrn2 T A 1: 132,865,538 (GRCm39) V201E probably damaging Het
Ly6l A T 15: 75,323,027 (GRCm39) T68S probably benign Het
Marchf1 G T 8: 66,839,763 (GRCm39) R182L possibly damaging Het
Megf6 A G 4: 154,333,882 (GRCm39) probably null Het
Mga T A 2: 119,794,793 (GRCm39) S2708T probably benign Het
Mx1 T C 16: 97,252,933 (GRCm39) T396A probably benign Het
Naip5 A C 13: 100,359,209 (GRCm39) S676A probably benign Het
Npepl1 G T 2: 173,963,337 (GRCm39) W456C probably benign Het
Ntrk2 A G 13: 58,956,543 (GRCm39) M1V probably null Het
Nufip1 T C 14: 76,372,340 (GRCm39) *485Q probably null Het
Or10x1 A T 1: 174,196,698 (GRCm39) T72S probably damaging Het
Or1o11 C T 17: 37,756,570 (GRCm39) L53F probably benign Het
Or4f57 A G 2: 111,791,175 (GRCm39) M81T probably damaging Het
Or55b4 G A 7: 102,133,586 (GRCm39) S247F probably damaging Het
Ptprq A T 10: 107,359,374 (GRCm39) M2243K probably damaging Het
Rad51b C T 12: 79,371,856 (GRCm39) Q190* probably null Het
Resf1 C T 6: 149,228,076 (GRCm39) T374I probably damaging Het
Rfx8 T C 1: 39,727,779 (GRCm39) Y182C probably benign Het
Rpgrip1l C A 8: 91,979,541 (GRCm39) R967L possibly damaging Het
Scube2 A G 7: 109,430,931 (GRCm39) Y423H possibly damaging Het
Sipa1l2 A T 8: 126,195,312 (GRCm39) Y809N probably damaging Het
Slc35f1 C A 10: 52,809,317 (GRCm39) Y101* probably null Het
Tbc1d22a A G 15: 86,098,809 (GRCm39) K12E possibly damaging Het
Tent2 T C 13: 93,312,055 (GRCm39) D215G probably damaging Het
Tmcc2 C T 1: 132,285,429 (GRCm39) V646M probably damaging Het
Tpp1 A T 7: 105,398,587 (GRCm39) M243K probably damaging Het
Trappc12 A G 12: 28,741,513 (GRCm39) L732P probably damaging Het
U2af2 A T 7: 5,082,179 (GRCm39) probably null Het
Utrn T A 10: 12,540,795 (GRCm39) N1877Y probably damaging Het
Vsir C T 10: 60,193,816 (GRCm39) T93I probably damaging Het
Zkscan5 T A 5: 145,142,112 (GRCm39) M3K possibly damaging Het
Zscan29 G T 2: 120,994,518 (GRCm39) T489N probably damaging Het
Other mutations in Ocln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ocln APN 13 100,671,521 (GRCm39) missense probably damaging 1.00
IGL02231:Ocln APN 13 100,677,622 (GRCm39) missense probably damaging 1.00
LCD18:Ocln UTSW 13 100,657,075 (GRCm39) intron probably benign
R0635:Ocln UTSW 13 100,642,744 (GRCm39) missense probably damaging 1.00
R1809:Ocln UTSW 13 100,647,967 (GRCm39) nonsense probably null
R2047:Ocln UTSW 13 100,671,632 (GRCm39) missense probably damaging 1.00
R2193:Ocln UTSW 13 100,676,412 (GRCm39) missense probably damaging 0.99
R2259:Ocln UTSW 13 100,671,537 (GRCm39) missense probably damaging 1.00
R3793:Ocln UTSW 13 100,635,402 (GRCm39) missense possibly damaging 0.50
R4534:Ocln UTSW 13 100,648,112 (GRCm39) missense possibly damaging 0.63
R4947:Ocln UTSW 13 100,676,223 (GRCm39) missense probably damaging 1.00
R5055:Ocln UTSW 13 100,675,930 (GRCm39) missense probably benign 0.11
R5061:Ocln UTSW 13 100,676,106 (GRCm39) missense probably damaging 1.00
R5218:Ocln UTSW 13 100,642,822 (GRCm39) missense probably damaging 1.00
R5302:Ocln UTSW 13 100,642,807 (GRCm39) missense probably damaging 0.99
R6257:Ocln UTSW 13 100,676,017 (GRCm39) missense probably benign 0.00
R6797:Ocln UTSW 13 100,676,223 (GRCm39) missense probably damaging 1.00
R6960:Ocln UTSW 13 100,635,380 (GRCm39) missense possibly damaging 0.89
R6967:Ocln UTSW 13 100,675,796 (GRCm39) nonsense probably null
R7000:Ocln UTSW 13 100,671,470 (GRCm39) critical splice donor site probably null
R7176:Ocln UTSW 13 100,651,591 (GRCm39) missense probably benign 0.16
R7176:Ocln UTSW 13 100,651,590 (GRCm39) missense probably damaging 0.97
R7709:Ocln UTSW 13 100,676,106 (GRCm39) missense probably damaging 1.00
R8784:Ocln UTSW 13 100,676,050 (GRCm39) missense probably damaging 1.00
R8790:Ocln UTSW 13 100,642,727 (GRCm39) missense probably benign 0.00
R9430:Ocln UTSW 13 100,676,356 (GRCm39) missense possibly damaging 0.68
X0023:Ocln UTSW 13 100,648,090 (GRCm39) missense probably benign 0.00
Z1088:Ocln UTSW 13 100,671,560 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATATCTACAGTTCTGAGTTGAGG -3'
(R):5'- CAGAGGGTACTCACAAATCATTTTCTC -3'

Sequencing Primer
(F):5'- TGGCCCATGTCTGAAATGC -3'
(R):5'- CTTCTGATTCTCAGGGAATATCCAC -3'
Posted On 2017-02-28