Incidental Mutation 'R5916:Ocln'
ID 461357
Institutional Source Beutler Lab
Gene Symbol Ocln
Ensembl Gene ENSMUSG00000021638
Gene Name occludin
Synonyms Ocl
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock # R5916 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 100496507-100552718 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 100506179 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 216 (D216A)
Ref Sequence ENSEMBL: ENSMUSP00000125642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022140] [ENSMUST00000069756] [ENSMUST00000159459] [ENSMUST00000160859]
AlphaFold Q61146
Predicted Effect probably benign
Transcript: ENSMUST00000022140
AA Change: D465A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022140
Gene: ENSMUSG00000021638
AA Change: D465A

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069756
AA Change: D465A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065284
Gene: ENSMUSG00000021638
AA Change: D465A

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 3.3e-29 PFAM
Pfam:Occludin_ELL 419 518 3.8e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159459
AA Change: D216A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125642
Gene: ENSMUSG00000021638
AA Change: D216A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Occludin_ELL 170 269 6.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160859
AA Change: D465A

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124849
Gene: ENSMUSG00000021638
AA Change: D465A

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous null mice display gastritis, loss of gastric parietal and chief cells, gastric mucus cell hyperplasia, reduced gastric acid secretion, growth retardation, male infertility, seminiferous tubule atrophy, failure to nurse pups, mineral deposits in the brain, and thinning of the compact bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Scube2 A G 7: 109,831,724 Y423H possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Ocln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ocln APN 13 100535013 missense probably damaging 1.00
IGL02231:Ocln APN 13 100541114 missense probably damaging 1.00
LCD18:Ocln UTSW 13 100520567 intron probably benign
R0635:Ocln UTSW 13 100506236 missense probably damaging 1.00
R1809:Ocln UTSW 13 100511459 nonsense probably null
R2047:Ocln UTSW 13 100535124 missense probably damaging 1.00
R2193:Ocln UTSW 13 100539904 missense probably damaging 0.99
R2259:Ocln UTSW 13 100535029 missense probably damaging 1.00
R3793:Ocln UTSW 13 100498894 missense possibly damaging 0.50
R4534:Ocln UTSW 13 100511604 missense possibly damaging 0.63
R4947:Ocln UTSW 13 100539715 missense probably damaging 1.00
R5055:Ocln UTSW 13 100539422 missense probably benign 0.11
R5061:Ocln UTSW 13 100539598 missense probably damaging 1.00
R5218:Ocln UTSW 13 100506314 missense probably damaging 1.00
R5302:Ocln UTSW 13 100506299 missense probably damaging 0.99
R6257:Ocln UTSW 13 100539509 missense probably benign 0.00
R6797:Ocln UTSW 13 100539715 missense probably damaging 1.00
R6960:Ocln UTSW 13 100498872 missense possibly damaging 0.89
R6967:Ocln UTSW 13 100539288 nonsense probably null
R7000:Ocln UTSW 13 100534962 critical splice donor site probably null
R7176:Ocln UTSW 13 100515082 missense probably damaging 0.97
R7176:Ocln UTSW 13 100515083 missense probably benign 0.16
R7709:Ocln UTSW 13 100539598 missense probably damaging 1.00
R8784:Ocln UTSW 13 100539542 missense probably damaging 1.00
R8790:Ocln UTSW 13 100506219 missense probably benign 0.00
R9430:Ocln UTSW 13 100539848 missense possibly damaging 0.68
X0023:Ocln UTSW 13 100511582 missense probably benign 0.00
Z1088:Ocln UTSW 13 100535052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCATATCTACAGTTCTGAGTTGAGG -3'
(R):5'- CAGAGGGTACTCACAAATCATTTTCTC -3'

Sequencing Primer
(F):5'- TGGCCCATGTCTGAAATGC -3'
(R):5'- CTTCTGATTCTCAGGGAATATCCAC -3'
Posted On 2017-02-28