Incidental Mutation 'R0565:Trim11'
ID46136
Institutional Source Beutler Lab
Gene Symbol Trim11
Ensembl Gene ENSMUSG00000020455
Gene Nametripartite motif-containing 11
Synonyms
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R0565 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58978093-58991458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58990584 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 434 (S434R)
Ref Sequence ENSEMBL: ENSMUSP00000104438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047441] [ENSMUST00000093061] [ENSMUST00000108809] [ENSMUST00000108810]
Predicted Effect probably benign
Transcript: ENSMUST00000047441
SMART Domains Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462

DomainStartEndE-ValueType
IGc2 21 88 8e-12 SMART
IGc2 121 190 8.31e-10 SMART
low complexity region 191 207 N/A INTRINSIC
IGc2 248 316 4.63e-8 SMART
IG 337 417 5.32e-8 SMART
IG_like 425 506 1.5e2 SMART
FN3 510 596 2.11e-9 SMART
IG 711 790 2.39e-1 SMART
IGc2 876 942 2.54e-5 SMART
IGc2 968 1034 2.54e-5 SMART
IGc2 1060 1126 4.49e-6 SMART
IGc2 1152 1218 7.82e-6 SMART
IGc2 1244 1310 5.16e-6 SMART
IGc2 1336 1402 1.93e-5 SMART
IGc2 1428 1494 1.93e-5 SMART
IGc2 1520 1586 1.93e-5 SMART
IGc2 1612 1678 1.93e-5 SMART
IGc2 1704 1770 1.93e-5 SMART
IGc2 1796 1862 7.94e-7 SMART
IG 1882 1962 5.37e-4 SMART
IG 1972 2051 9.93e-8 SMART
IG 2062 2141 2.48e-8 SMART
IG 2151 2230 3.89e-1 SMART
IG 2240 2319 1.92e0 SMART
IG 2329 2407 6.45e-7 SMART
IG 2452 2531 1.22e-7 SMART
IGc2 2637 2703 9.93e-8 SMART
low complexity region 2705 2716 N/A INTRINSIC
IG 2720 2799 2.44e0 SMART
IGc2 2815 2881 2.1e-6 SMART
IG 2898 2979 2.86e0 SMART
IGc2 2995 3061 8.38e-6 SMART
IG 3078 3157 1.2e-6 SMART
IG 3167 3248 1.42e-3 SMART
IGc2 3264 3330 3.85e-5 SMART
IGc2 3353 3419 3.13e-5 SMART
IGc2 3442 3507 3.3e-4 SMART
IGc2 3530 3595 5.84e-5 SMART
IGc2 3618 3683 1.29e-6 SMART
IG_like 3706 3771 3.16e-1 SMART
IGc2 3779 3844 1.46e-5 SMART
IGc2 3867 3932 1.56e-5 SMART
IGc2 3955 4020 1.19e-5 SMART
IGc2 4043 4108 1.93e-5 SMART
IG 4125 4203 1.85e-7 SMART
IGc2 4219 4285 5.08e-5 SMART
IGc2 4308 4374 1.11e-5 SMART
IGc2 4397 4465 6.71e-5 SMART
IG 4482 4564 2.06e-5 SMART
IG 4574 4655 5.01e-4 SMART
IG 4664 4746 1.04e-1 SMART
FN3 4749 4831 2.44e-14 SMART
IG 4858 4940 3.68e-2 SMART
IQ 5100 5122 3.65e-4 SMART
IGc2 5139 5207 8.72e-4 SMART
low complexity region 5215 5231 N/A INTRINSIC
low complexity region 5232 5248 N/A INTRINSIC
low complexity region 5251 5274 N/A INTRINSIC
IGc2 5369 5437 3.25e-12 SMART
low complexity region 5450 5466 N/A INTRINSIC
IG 5496 5580 1.55e0 SMART
IGc2 5612 5685 1.82e-6 SMART
low complexity region 5799 5829 N/A INTRINSIC
SH3 5832 5895 1.22e0 SMART
Pfam:RhoGEF 5926 6104 4.5e-21 PFAM
PH 6125 6235 2.74e-11 SMART
IGc2 6255 6323 3.73e-12 SMART
IGc2 6349 6418 1.18e-14 SMART
IGc2 6464 6531 1.7e-6 SMART
S_TKc 6562 6815 1.66e-79 SMART
Blast:STYKc 6843 6935 5e-39 BLAST
low complexity region 6939 6954 N/A INTRINSIC
low complexity region 7013 7029 N/A INTRINSIC
low complexity region 7146 7161 N/A INTRINSIC
low complexity region 7199 7219 N/A INTRINSIC
low complexity region 7499 7514 N/A INTRINSIC
IGc2 7538 7606 6.3e-10 SMART
FN3 7620 7698 9.33e-2 SMART
STYKc 7736 7988 8.55e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093061
AA Change: S418R

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090749
Gene: ENSMUSG00000020455
AA Change: S418R

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 285 337 4.1e-24 SMART
SPRY 338 457 2.58e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108809
SMART Domains Protein: ENSMUSP00000104437
Gene: ENSMUSG00000020455

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108810
AA Change: S434R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104438
Gene: ENSMUSG00000020455
AA Change: S434R

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 301 353 4.1e-24 SMART
SPRY 354 473 2.58e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138587
SMART Domains Protein: ENSMUSP00000121092
Gene: ENSMUSG00000061462

DomainStartEndE-ValueType
IG 2 83 1.28e-1 SMART
low complexity region 186 216 N/A INTRINSIC
SH3 219 282 1.22e0 SMART
Pfam:RhoGEF 313 491 6.1e-22 PFAM
PH 512 622 2.74e-11 SMART
IGc2 642 710 3.73e-12 SMART
IGc2 736 805 1.18e-14 SMART
low complexity region 843 857 N/A INTRINSIC
IGc2 985 1052 1.7e-6 SMART
S_TKc 1083 1336 1.66e-79 SMART
Blast:STYKc 1364 1456 1e-38 BLAST
low complexity region 1460 1475 N/A INTRINSIC
low complexity region 1534 1550 N/A INTRINSIC
low complexity region 1667 1682 N/A INTRINSIC
low complexity region 1720 1740 N/A INTRINSIC
low complexity region 2020 2035 N/A INTRINSIC
IGc2 2059 2127 6.3e-10 SMART
FN3 2141 2219 9.33e-2 SMART
STYKc 2257 2509 8.55e-41 SMART
Meta Mutation Damage Score 0.3724 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nucleus and the cytoplasm. Its function has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Trim11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Trim11 APN 11 58990697 missense probably benign
R0453:Trim11 UTSW 11 58990535 missense probably damaging 1.00
R2061:Trim11 UTSW 11 58982063 missense probably damaging 1.00
R4783:Trim11 UTSW 11 58988924 missense probably null 1.00
R5004:Trim11 UTSW 11 58981338 critical splice donor site probably benign
R5847:Trim11 UTSW 11 58990593 missense probably damaging 1.00
R6027:Trim11 UTSW 11 58978463 missense possibly damaging 0.76
R6928:Trim11 UTSW 11 58988843 missense probably damaging 1.00
R7128:Trim11 UTSW 11 58978277 missense probably damaging 1.00
R7389:Trim11 UTSW 11 58990655 missense probably damaging 1.00
R7485:Trim11 UTSW 11 58978637 missense probably benign 0.00
R7535:Trim11 UTSW 11 58982065 missense probably damaging 0.99
R7629:Trim11 UTSW 11 58978334 missense probably damaging 1.00
R7734:Trim11 UTSW 11 58978354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGTGTGTAAAGAAACTGCCAAC -3'
(R):5'- TCAGAAAGGCACTGTGTGCTCCTC -3'

Sequencing Primer
(F):5'- TGTAAAGAAACTGCCAACAGGAAG -3'
(R):5'- GTGTGCTCCTCCTAATGCG -3'
Posted On2013-06-11