Incidental Mutation 'R5916:Tbc1d22a'
ID 461361
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene Name TBC1 domain family, member 22a
Synonyms D15Ertd781e
MMRRC Submission 044113-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5916 (G1)
Quality Score 97
Status Not validated
Chromosome 15
Chromosomal Location 86098660-86382704 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86098809 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 12 (K12E)
Ref Sequence ENSEMBL: ENSMUSP00000065721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414]
AlphaFold Q8R5A6
Predicted Effect possibly damaging
Transcript: ENSMUST00000063414
AA Change: K12E

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: K12E

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157446
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,349,550 (GRCm39) N269I possibly damaging Het
Abcc1 G T 16: 14,283,006 (GRCm39) V1161F possibly damaging Het
Adam3 A T 8: 25,174,555 (GRCm39) probably null Het
Agt A T 8: 125,290,597 (GRCm39) S237T possibly damaging Het
Ano3 A T 2: 110,512,181 (GRCm39) F674L probably benign Het
Asb2 G T 12: 103,290,135 (GRCm39) A504E probably damaging Het
Atp13a1 T A 8: 70,259,748 (GRCm39) I1113N probably damaging Het
Atxn7l2 T C 3: 108,112,978 (GRCm39) probably null Het
Bambi A G 18: 3,511,463 (GRCm39) T95A probably benign Het
Cfap210 A T 2: 69,619,806 (GRCm39) M1K probably null Het
Clrn1 T C 3: 58,753,783 (GRCm39) T193A probably benign Het
Colgalt2 T A 1: 152,379,873 (GRCm39) D437E probably damaging Het
Dchs1 C A 7: 105,408,373 (GRCm39) A1820S probably damaging Het
Dnah12 T A 14: 26,428,073 (GRCm39) I233N possibly damaging Het
Dsc3 T C 18: 20,120,077 (GRCm39) N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 (GRCm39) probably null Het
Erich3 A T 3: 154,401,460 (GRCm39) R36S probably damaging Het
Fam243 T A 16: 92,117,559 (GRCm39) E243V probably damaging Het
Fmnl3 A T 15: 99,219,709 (GRCm39) C680S probably damaging Het
Focad T C 4: 88,275,778 (GRCm39) L1129P unknown Het
Fzd3 G A 14: 65,440,178 (GRCm39) T664I probably benign Het
Glb1l3 T C 9: 26,766,032 (GRCm39) I129V probably benign Het
Heatr1 T C 13: 12,449,352 (GRCm39) F1950S probably damaging Het
Herc6 G A 6: 57,623,188 (GRCm39) G597E probably benign Het
Hmcn2 T A 2: 31,286,151 (GRCm39) V2101D probably damaging Het
Il17re T A 6: 113,447,084 (GRCm39) C612S probably damaging Het
Il36g T G 2: 24,082,806 (GRCm39) *194E probably null Het
Junb T C 8: 85,704,505 (GRCm39) Y185C probably benign Het
Lrriq1 G A 10: 103,057,243 (GRCm39) Q186* probably null Het
Lrrn2 T A 1: 132,865,538 (GRCm39) V201E probably damaging Het
Ly6l A T 15: 75,323,027 (GRCm39) T68S probably benign Het
Marchf1 G T 8: 66,839,763 (GRCm39) R182L possibly damaging Het
Megf6 A G 4: 154,333,882 (GRCm39) probably null Het
Mga T A 2: 119,794,793 (GRCm39) S2708T probably benign Het
Mx1 T C 16: 97,252,933 (GRCm39) T396A probably benign Het
Naip5 A C 13: 100,359,209 (GRCm39) S676A probably benign Het
Npepl1 G T 2: 173,963,337 (GRCm39) W456C probably benign Het
Ntrk2 A G 13: 58,956,543 (GRCm39) M1V probably null Het
Nufip1 T C 14: 76,372,340 (GRCm39) *485Q probably null Het
Ocln T G 13: 100,642,687 (GRCm39) D216A possibly damaging Het
Or10x1 A T 1: 174,196,698 (GRCm39) T72S probably damaging Het
Or1o11 C T 17: 37,756,570 (GRCm39) L53F probably benign Het
Or4f57 A G 2: 111,791,175 (GRCm39) M81T probably damaging Het
Or55b4 G A 7: 102,133,586 (GRCm39) S247F probably damaging Het
Ptprq A T 10: 107,359,374 (GRCm39) M2243K probably damaging Het
Rad51b C T 12: 79,371,856 (GRCm39) Q190* probably null Het
Resf1 C T 6: 149,228,076 (GRCm39) T374I probably damaging Het
Rfx8 T C 1: 39,727,779 (GRCm39) Y182C probably benign Het
Rpgrip1l C A 8: 91,979,541 (GRCm39) R967L possibly damaging Het
Scube2 A G 7: 109,430,931 (GRCm39) Y423H possibly damaging Het
Sipa1l2 A T 8: 126,195,312 (GRCm39) Y809N probably damaging Het
Slc35f1 C A 10: 52,809,317 (GRCm39) Y101* probably null Het
Tent2 T C 13: 93,312,055 (GRCm39) D215G probably damaging Het
Tmcc2 C T 1: 132,285,429 (GRCm39) V646M probably damaging Het
Tpp1 A T 7: 105,398,587 (GRCm39) M243K probably damaging Het
Trappc12 A G 12: 28,741,513 (GRCm39) L732P probably damaging Het
U2af2 A T 7: 5,082,179 (GRCm39) probably null Het
Utrn T A 10: 12,540,795 (GRCm39) N1877Y probably damaging Het
Vsir C T 10: 60,193,816 (GRCm39) T93I probably damaging Het
Zkscan5 T A 5: 145,142,112 (GRCm39) M3K possibly damaging Het
Zscan29 G T 2: 120,994,518 (GRCm39) T489N probably damaging Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86,185,756 (GRCm39) missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86,275,404 (GRCm39) missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86,183,870 (GRCm39) missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86,123,372 (GRCm39) missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86,176,335 (GRCm39) missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86,381,027 (GRCm39) missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86,235,852 (GRCm39) splice site probably null
R1703:Tbc1d22a UTSW 15 86,123,416 (GRCm39) missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86,119,770 (GRCm39) missense possibly damaging 0.48
R1925:Tbc1d22a UTSW 15 86,123,350 (GRCm39) missense probably damaging 1.00
R2014:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86,183,885 (GRCm39) missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86,275,266 (GRCm39) splice site probably null
R4380:Tbc1d22a UTSW 15 86,235,935 (GRCm39) missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86,119,886 (GRCm39) missense probably damaging 1.00
R4690:Tbc1d22a UTSW 15 86,196,037 (GRCm39) missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86,235,935 (GRCm39) missense probably damaging 1.00
R4883:Tbc1d22a UTSW 15 86,381,117 (GRCm39) missense possibly damaging 0.91
R4920:Tbc1d22a UTSW 15 86,195,949 (GRCm39) missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86,275,287 (GRCm39) missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86,235,929 (GRCm39) missense probably damaging 0.98
R6360:Tbc1d22a UTSW 15 86,098,830 (GRCm39) missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86,185,768 (GRCm39) missense possibly damaging 0.48
R7138:Tbc1d22a UTSW 15 86,123,356 (GRCm39) missense probably benign 0.07
R7294:Tbc1d22a UTSW 15 86,196,036 (GRCm39) missense possibly damaging 0.90
R7645:Tbc1d22a UTSW 15 86,119,742 (GRCm39) missense probably benign 0.01
R7704:Tbc1d22a UTSW 15 86,250,876 (GRCm39) missense probably damaging 1.00
R9204:Tbc1d22a UTSW 15 86,098,803 (GRCm39) missense probably benign 0.15
R9370:Tbc1d22a UTSW 15 86,123,441 (GRCm39) missense probably benign 0.00
R9459:Tbc1d22a UTSW 15 86,120,021 (GRCm39) missense possibly damaging 0.57
R9792:Tbc1d22a UTSW 15 86,119,839 (GRCm39) missense probably damaging 0.99
R9793:Tbc1d22a UTSW 15 86,119,839 (GRCm39) missense probably damaging 0.99
RF013:Tbc1d22a UTSW 15 86,183,975 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAATCGCCGAGTCACAACTTC -3'
(R):5'- TCCTTGCTCATTGGTACGGC -3'

Sequencing Primer
(F):5'- AGTCACAACTTCCGGACGGAG -3'
(R):5'- TGGTACGGCCACTGTCAC -3'
Posted On 2017-02-28