Incidental Mutation 'R0565:Cfap52'
ID46137
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Namecilia and flagella associated protein 52
Synonyms4933417B11Rik, Wdr16, 1700019F09Rik
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R0565 (G1)
Quality Score147
Status Validated
Chromosome11
Chromosomal Location67924806-67965651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67949599 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 169 (C169S)
Ref Sequence ENSEMBL: ENSMUSP00000021287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287] [ENSMUST00000126766]
Predicted Effect probably benign
Transcript: ENSMUST00000021287
AA Change: C169S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: C169S

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126766
AA Change: C169S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116496
Gene: ENSMUSG00000020904
AA Change: C169S

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
Blast:WD40 190 233 4e-12 BLAST
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
Blast:WD40 321 342 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142929
Meta Mutation Damage Score 0.1013 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67953580 missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67946292 splice site probably null
IGL02530:Cfap52 APN 11 67954181 splice site probably benign
IGL02558:Cfap52 APN 11 67954138 missense probably benign 0.31
IGL02873:Cfap52 APN 11 67931782 missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67953515 missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67954075 missense probably benign
IGL03068:Cfap52 APN 11 67935856 missense probably benign 0.11
IGL03216:Cfap52 APN 11 67954106 missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67935976 unclassified probably benign
IGL03370:Cfap52 APN 11 67939055 missense probably damaging 0.98
chewbacca UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0244:Cfap52 UTSW 11 67926382 missense possibly damaging 0.90
R0306:Cfap52 UTSW 11 67954070 missense probably benign
R0364:Cfap52 UTSW 11 67953610 missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67954088 missense probably benign
R1068:Cfap52 UTSW 11 67939004 missense probably benign 0.10
R1082:Cfap52 UTSW 11 67925172 missense probably damaging 0.99
R1509:Cfap52 UTSW 11 67938993 missense probably benign 0.00
R1894:Cfap52 UTSW 11 67953619 critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67939791 missense probably benign
R3954:Cfap52 UTSW 11 67930865 missense probably benign
R4611:Cfap52 UTSW 11 67926421 missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67931722 critical splice donor site probably null
R5624:Cfap52 UTSW 11 67927358 missense possibly damaging 0.92
R5762:Cfap52 UTSW 11 67954121 missense possibly damaging 0.71
R5970:Cfap52 UTSW 11 67930744 missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6260:Cfap52 UTSW 11 67938954 missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67949633 missense probably benign 0.02
R7580:Cfap52 UTSW 11 67946320 missense probably damaging 1.00
R7831:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
R7966:Cfap52 UTSW 11 67953745 splice site probably null
R8303:Cfap52 UTSW 11 67939795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGGTTCGTTCAGTGCTCAAGAC -3'
(R):5'- TGTTTACATGAGACGGAGGCTTGC -3'

Sequencing Primer
(F):5'- GTTCAGTGCTCAAGACATATTCC -3'
(R):5'- caccagaagagggcatcag -3'
Posted On2013-06-11