Mutagenetix > Incidental Mutation

Incidental Mutation 'R5917:Mmrn1'

461389

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

044114-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5917 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 60973150 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000129603

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000204333

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	C	6: 149,334,681	F1500L	probably damaging	Het
Abcb5	T	A	12: 118,868,781	R1153*	probably null	Het
Amdhd1	T	C	10: 93,524,470	H409R	possibly damaging	Het
Anks1b	C	T	10: 90,576,941		probably benign	Het
Ascc2	T	C	11: 4,681,506	L649P	probably benign	Het
Chst15	A	G	7: 132,270,517	F12L	probably benign	Het
Clec4a4	A	T	6: 123,004,058	K83N	probably benign	Het
Comp	T	A	8: 70,376,361		probably null	Het
Cryz	T	A	3: 154,621,766	S144T	probably benign	Het
Ctss	A	G	3: 95,543,113	D125G	probably benign	Het
Dact1	G	T	12: 71,318,682	V746L	possibly damaging	Het
Dhx29	A	G	13: 112,962,843	H1134R	probably damaging	Het
Dlgap4	A	G	2: 156,704,540	D376G	probably damaging	Het
Dnah3	T	A	7: 120,016,526	H1660L	probably damaging	Het
Ep300	T	A	15: 81,628,607		probably benign	Het
Fbxo30	A	T	10: 11,289,518		probably null	Het
Fcrls	T	A	3: 87,256,787	H345L	probably damaging	Het
Galnt11	C	A	5: 25,247,672		probably null	Het
Il31ra	A	G	13: 112,546,312	C87R	probably benign	Het
Itga4	A	T	2: 79,287,098	Q416L	probably damaging	Het
Kcnt2	A	T	1: 140,533,928	T806S	probably damaging	Het
Lama2	A	G	10: 27,190,697	S1063P	probably damaging	Het
Lama4	T	A	10: 39,048,032	S479T	probably benign	Het
Lgi4	C	T	7: 31,060,178	T53M	possibly damaging	Het
Limk1	A	G	5: 134,657,935	F533L	probably damaging	Het
Loxl1	A	G	9: 58,312,723	L55P	probably damaging	Het
Map1a	A	G	2: 121,305,216	E1933G	probably damaging	Het
Matn2	T	A	15: 34,409,766	C447*	probably null	Het
Olfr1196	A	T	2: 88,700,705	I208N	possibly damaging	Het
Olfr13	C	T	6: 43,174,712	S242F	probably damaging	Het
Olfr464	A	T	11: 87,914,389	N172K	probably damaging	Het
Otor	A	G	2: 143,078,511	I4M	probably benign	Het
P2rx3	A	T	2: 85,035,247	V18E	probably damaging	Het
Pcdh7	T	C	5: 57,721,755	V884A	probably damaging	Het
Pcdhb4	T	A	18: 37,309,566	V643D	probably damaging	Het
Pelo	A	G	13: 115,089,394	S176P	possibly damaging	Het
Ppp2r3a	A	T	9: 101,211,984	V380E	probably benign	Het
Proc	T	A	18: 32,127,460	D204V	probably benign	Het
Prpsap2	C	T	11: 61,737,044	R202H	probably damaging	Het
Rtl1	T	G	12: 109,591,653	T1251P	possibly damaging	Het
Sema6a	T	G	18: 47,281,338	I482L	probably benign	Het
Smpdl3a	T	A	10: 57,805,558		probably null	Het
Strc	T	A	2: 121,379,309	M178L	probably benign	Het
Taok1	A	T	11: 77,560,318	M312K	probably damaging	Het
Tle2	T	C	10: 81,580,916		probably null	Het
Tle3	A	G	9: 61,408,908	D296G	probably benign	Het
Trank1	A	G	9: 111,362,417	D498G	probably benign	Het
Vars	C	A	17: 35,012,515	L672M	probably damaging	Het
Vps13d	G	A	4: 145,100,010	T2866I	probably damaging	Het
Zfp423	C	A	8: 87,782,232	E370*	probably null	Het
Zfp521	T	A	18: 13,845,555	K600N	probably damaging	Het
Zfp788	A	G	7: 41,649,148	K351E	probably benign	Het
Zfp963	A	T	8: 69,742,860		probably null	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GTTGAATGGTCCCAACTCTCTC -3'
(R):5'- ACCAGTGGGCTCATCCTAAC -3'

Sequencing Primer
(F):5'- ATGCAGCCATGATTCAAAAACTGG -3'
(R):5'- CAGTGGGCTCATCCTAACTATGG -3'

Posted On

2017-02-28