Incidental Mutation 'R5917:Mmrn1'
ID461389
Institutional Source Beutler Lab
Gene Symbol Mmrn1
Ensembl Gene ENSMUSG00000054641
Gene Namemultimerin 1
Synonyms4921530G03Rik, Emilin4
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location60924976-60989378 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 60973150 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]
Predicted Effect probably null
Transcript: ENSMUST00000129603
SMART Domains Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 3.3e-12 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1026 1059 1.62e-5 SMART
C1Q 1076 1210 6.74e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204333
SMART Domains Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Pfam:EMI 193 262 7.7e-13 PFAM
coiled coil region 303 338 N/A INTRINSIC
coiled coil region 658 688 N/A INTRINSIC
coiled coil region 808 846 N/A INTRINSIC
low complexity region 981 992 N/A INTRINSIC
EGF 1025 1058 1.62e-5 SMART
C1Q 1075 1209 6.74e-49 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Mmrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Mmrn1 APN 6 60977513 missense probably benign
IGL00742:Mmrn1 APN 6 60958120 missense probably damaging 1.00
IGL00917:Mmrn1 APN 6 60975910 nonsense probably null
IGL01121:Mmrn1 APN 6 60975944 missense possibly damaging 0.46
IGL01393:Mmrn1 APN 6 60960708 splice site probably benign
IGL01697:Mmrn1 APN 6 60976493 missense possibly damaging 0.46
IGL01737:Mmrn1 APN 6 60977161 missense probably benign
IGL01944:Mmrn1 APN 6 60971183 critical splice donor site probably null
IGL01987:Mmrn1 APN 6 60944573 missense probably benign 0.31
IGL02005:Mmrn1 APN 6 60960744 missense probably damaging 1.00
IGL02190:Mmrn1 APN 6 60987193 missense probably benign 0.13
IGL02335:Mmrn1 APN 6 60977147 missense possibly damaging 0.79
IGL02421:Mmrn1 APN 6 60944822 missense probably benign 0.00
IGL02530:Mmrn1 APN 6 60958176 missense possibly damaging 0.73
IGL02709:Mmrn1 APN 6 60973046 missense probably damaging 1.00
IGL03139:Mmrn1 APN 6 60976340 missense probably damaging 0.99
IGL03228:Mmrn1 APN 6 60944892 missense probably benign 0.02
IGL03272:Mmrn1 APN 6 60988435 missense probably damaging 1.00
IGL03410:Mmrn1 APN 6 60975835 missense probably benign 0.36
H8562:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
K2124:Mmrn1 UTSW 6 60976033 missense possibly damaging 0.87
R0145:Mmrn1 UTSW 6 60973010 missense probably damaging 1.00
R0164:Mmrn1 UTSW 6 60975815 splice site probably benign
R0352:Mmrn1 UTSW 6 60944971 missense probably benign 0.03
R0400:Mmrn1 UTSW 6 60977115 missense probably benign 0.00
R0538:Mmrn1 UTSW 6 60976469 missense probably benign 0.00
R0907:Mmrn1 UTSW 6 60973119 missense probably benign 0.09
R1117:Mmrn1 UTSW 6 60976325 missense possibly damaging 0.51
R1383:Mmrn1 UTSW 6 60976322 missense probably damaging 1.00
R1542:Mmrn1 UTSW 6 60945118 missense probably damaging 0.98
R1591:Mmrn1 UTSW 6 60944771 nonsense probably null
R1599:Mmrn1 UTSW 6 60945037 missense probably benign
R1733:Mmrn1 UTSW 6 60977101 missense probably benign 0.00
R2005:Mmrn1 UTSW 6 60976084 missense possibly damaging 0.88
R2056:Mmrn1 UTSW 6 60944805 missense probably benign 0.00
R2144:Mmrn1 UTSW 6 60945075 missense possibly damaging 0.54
R2299:Mmrn1 UTSW 6 60976441 missense probably damaging 0.99
R3836:Mmrn1 UTSW 6 60944847 missense probably benign
R3837:Mmrn1 UTSW 6 60944847 missense probably benign
R4206:Mmrn1 UTSW 6 60958180 missense probably damaging 0.98
R4414:Mmrn1 UTSW 6 60944586 missense probably damaging 1.00
R4590:Mmrn1 UTSW 6 60960813 missense probably damaging 1.00
R4707:Mmrn1 UTSW 6 60988473 missense probably benign 0.12
R4820:Mmrn1 UTSW 6 60973043 missense probably benign 0.04
R4880:Mmrn1 UTSW 6 60976439 missense probably benign 0.15
R5166:Mmrn1 UTSW 6 60976490 missense probably benign 0.04
R5324:Mmrn1 UTSW 6 60976586 missense probably damaging 1.00
R5887:Mmrn1 UTSW 6 60987074 missense probably benign
R6108:Mmrn1 UTSW 6 60975976 missense possibly damaging 0.83
R6539:Mmrn1 UTSW 6 60987184 missense probably benign 0.01
R6996:Mmrn1 UTSW 6 60977383 missense probably benign 0.04
R7064:Mmrn1 UTSW 6 60988540 nonsense probably null
R7073:Mmrn1 UTSW 6 60988427 missense probably damaging 1.00
R7213:Mmrn1 UTSW 6 60944543 start gained probably benign
R7256:Mmrn1 UTSW 6 60976114 missense probably damaging 0.98
R7324:Mmrn1 UTSW 6 60944933 nonsense probably null
R7350:Mmrn1 UTSW 6 60976336 nonsense probably null
R7388:Mmrn1 UTSW 6 60976252 missense probably benign 0.43
X0026:Mmrn1 UTSW 6 60976013 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTGAATGGTCCCAACTCTCTC -3'
(R):5'- ACCAGTGGGCTCATCCTAAC -3'

Sequencing Primer
(F):5'- ATGCAGCCATGATTCAAAAACTGG -3'
(R):5'- CAGTGGGCTCATCCTAACTATGG -3'
Posted On2017-02-28