Incidental Mutation 'R5917:Amdhd1'
ID461415
Institutional Source Beutler Lab
Gene Symbol Amdhd1
Ensembl Gene ENSMUSG00000015890
Gene Nameamidohydrolase domain containing 1
Synonyms
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location93523338-93540033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93524470 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 409 (H409R)
Ref Sequence ENSEMBL: ENSMUSP00000016034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016034]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016034
AA Change: H409R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000016034
Gene: ENSMUSG00000015890
AA Change: H409R

DomainStartEndE-ValueType
Pfam:Amidohydro_1 78 423 3.6e-21 PFAM
Pfam:Amidohydro_3 107 424 8.5e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Amdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Amdhd1 APN 10 93531568 missense probably benign
IGL02336:Amdhd1 APN 10 93524429 missense probably benign 0.23
IGL02538:Amdhd1 APN 10 93527246 missense probably damaging 0.99
IGL03162:Amdhd1 APN 10 93531475 splice site probably null
R0893:Amdhd1 UTSW 10 93527651 missense probably damaging 1.00
R1857:Amdhd1 UTSW 10 93531554 missense probably damaging 1.00
R2890:Amdhd1 UTSW 10 93527264 missense probably benign 0.02
R4159:Amdhd1 UTSW 10 93534650 missense probably damaging 1.00
R4768:Amdhd1 UTSW 10 93534484 missense possibly damaging 0.88
R4941:Amdhd1 UTSW 10 93531601 missense probably damaging 1.00
R5199:Amdhd1 UTSW 10 93525985 missense probably damaging 1.00
R6831:Amdhd1 UTSW 10 93527256 missense probably damaging 0.97
R7100:Amdhd1 UTSW 10 93537074 intron probably null
R7294:Amdhd1 UTSW 10 93534439 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAAATCTTTCCTTGAAGAGCTGTC -3'
(R):5'- CAGGCATACACCACTCATATGTATG -3'

Sequencing Primer
(F):5'- CTGGTACATAGCAGGTGAGTAC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2017-02-28