Incidental Mutation 'R0565:Caskin2'
ID46142
Institutional Source Beutler Lab
Gene Symbol Caskin2
Ensembl Gene ENSMUSG00000034471
Gene NameCASK-interacting protein 2
Synonyms1600028L06Rik
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R0565 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115799183-115813639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115801016 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 981 (E981G)
Ref Sequence ENSEMBL: ENSMUSP00000041328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041684] [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000132780]
Predicted Effect probably damaging
Transcript: ENSMUST00000041684
AA Change: E981G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471
AA Change: E981G

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093912
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103033
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125658
Predicted Effect probably benign
Transcript: ENSMUST00000132780
SMART Domains Protein: ENSMUSP00000119158
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 27 56 3.01e-4 SMART
ANK 60 89 3.41e-3 SMART
ANK 93 122 1.4e-4 SMART
ANK 126 155 3.26e0 SMART
ANK 167 196 3.33e-6 SMART
ANK 199 228 4.82e-3 SMART
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that contains six ankyrin repeats, as well as a Src homology 3 (SH3) domain and two sterile alpha motif (SAM) domains, which may be involved in protein-protein interactions. The C-terminal portion of this protein is proline-rich and contains a conserved region. A related protein interacts with calcium/calmodulin-dependent serine protein kinase (CASK). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Caskin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Caskin2 APN 11 115803599 missense probably benign 0.00
IGL01936:Caskin2 APN 11 115804717 missense probably damaging 0.99
IGL02322:Caskin2 APN 11 115804477 missense probably damaging 0.99
R0119:Caskin2 UTSW 11 115802427 unclassified probably benign
R0127:Caskin2 UTSW 11 115800994 missense probably damaging 1.00
R0741:Caskin2 UTSW 11 115804800 missense probably damaging 1.00
R1332:Caskin2 UTSW 11 115803345 unclassified probably benign
R1474:Caskin2 UTSW 11 115803696 missense probably benign 0.05
R1720:Caskin2 UTSW 11 115802782 missense probably damaging 1.00
R1968:Caskin2 UTSW 11 115803614 missense probably benign 0.00
R2054:Caskin2 UTSW 11 115806301 unclassified probably benign
R2061:Caskin2 UTSW 11 115803630 missense probably benign
R2893:Caskin2 UTSW 11 115801277 missense probably benign 0.00
R3036:Caskin2 UTSW 11 115806356 missense probably damaging 1.00
R3123:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R3124:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R4822:Caskin2 UTSW 11 115807299 missense probably damaging 1.00
R5095:Caskin2 UTSW 11 115800738 missense probably benign
R5654:Caskin2 UTSW 11 115800079 critical splice acceptor site probably null
R5743:Caskin2 UTSW 11 115802289 missense possibly damaging 0.66
R5801:Caskin2 UTSW 11 115803473 missense probably damaging 1.00
R5808:Caskin2 UTSW 11 115801763 missense probably damaging 1.00
R6259:Caskin2 UTSW 11 115800453 missense probably damaging 1.00
R6618:Caskin2 UTSW 11 115800029 missense possibly damaging 0.89
R7142:Caskin2 UTSW 11 115806736 missense probably benign 0.29
R7192:Caskin2 UTSW 11 115801376 missense probably damaging 1.00
R7247:Caskin2 UTSW 11 115801896 missense probably benign
R7290:Caskin2 UTSW 11 115804789 missense possibly damaging 0.63
R7451:Caskin2 UTSW 11 115812155 start gained probably benign
X0063:Caskin2 UTSW 11 115806412 missense probably damaging 1.00
Z1176:Caskin2 UTSW 11 115802096 missense probably damaging 1.00
Z1176:Caskin2 UTSW 11 115802103 missense probably damaging 1.00
Z1176:Caskin2 UTSW 11 115803620 missense probably benign 0.04
Z1177:Caskin2 UTSW 11 115806781 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGTTCCTTGCGATGGAAGGACG -3'
(R):5'- TTATGCCACGCTTACTCGGAGACC -3'

Sequencing Primer
(F):5'- ATGGAAGGACGCTGGGC -3'
(R):5'- TTCACTAGACGGAACCTCGG -3'
Posted On2013-06-11