Incidental Mutation 'R5917:Il31ra'
ID461425
Institutional Source Beutler Lab
Gene Symbol Il31ra
Ensembl Gene ENSMUSG00000050377
Gene Nameinterleukin 31 receptor A
SynonymsGLM-R, GPL
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112519898-112594360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112546312 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 87 (C87R)
Ref Sequence ENSEMBL: ENSMUSP00000153382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051756] [ENSMUST00000223752] [ENSMUST00000223819] [ENSMUST00000224510] [ENSMUST00000224576] [ENSMUST00000225397]
Predicted Effect probably benign
Transcript: ENSMUST00000051756
AA Change: C168R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058045
Gene: ENSMUSG00000050377
AA Change: C168R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
FN3 115 198 7.75e0 SMART
Blast:FN3 216 297 1e-40 BLAST
FN3 325 394 1.15e1 SMART
FN3 408 490 7.18e-3 SMART
low complexity region 508 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223752
Predicted Effect probably benign
Transcript: ENSMUST00000223819
AA Change: C195R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224070
Predicted Effect probably benign
Transcript: ENSMUST00000224510
AA Change: C87R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224576
Predicted Effect probably benign
Transcript: ENSMUST00000225397
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the type I cytokine receptor family. This receptor, with homology to gp130, is expressed on monocytes, and is involved in IL-31 signaling via activation of STAT-3 and STAT-5. It functions either as a monomer, or as part of a receptor complex with oncostatin M receptor (OSMR). Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous null mice display no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Proc T A 18: 32,127,460 D204V probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Il31ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Il31ra APN 13 112547478 missense possibly damaging 0.94
IGL00639:Il31ra APN 13 112549559 nonsense probably null
IGL01640:Il31ra APN 13 112531758 missense possibly damaging 0.58
IGL02009:Il31ra APN 13 112533867 missense probably damaging 0.98
IGL02431:Il31ra APN 13 112530296 missense probably damaging 1.00
IGL02675:Il31ra APN 13 112524352 missense probably benign 0.00
IGL02718:Il31ra APN 13 112530369 nonsense probably null
IGL03388:Il31ra APN 13 112546212 missense probably damaging 1.00
IGL03408:Il31ra APN 13 112525888 missense probably benign 0.21
R0482:Il31ra UTSW 13 112527481 missense possibly damaging 0.89
R0639:Il31ra UTSW 13 112525843 missense possibly damaging 0.95
R0905:Il31ra UTSW 13 112531673 missense probably damaging 1.00
R0948:Il31ra UTSW 13 112530378 missense possibly damaging 0.81
R1420:Il31ra UTSW 13 112531752 missense probably damaging 1.00
R1538:Il31ra UTSW 13 112547466 missense possibly damaging 0.91
R1776:Il31ra UTSW 13 112541239 missense probably damaging 0.97
R1931:Il31ra UTSW 13 112541222 missense probably damaging 1.00
R2006:Il31ra UTSW 13 112530356 missense probably damaging 1.00
R2134:Il31ra UTSW 13 112543888 missense possibly damaging 0.94
R3103:Il31ra UTSW 13 112530351 missense probably damaging 1.00
R4089:Il31ra UTSW 13 112551919 nonsense probably null
R4742:Il31ra UTSW 13 112523967 nonsense probably null
R4787:Il31ra UTSW 13 112527545 missense possibly damaging 0.82
R5154:Il31ra UTSW 13 112523997 missense possibly damaging 0.87
R5193:Il31ra UTSW 13 112524330 missense probably benign 0.34
R5402:Il31ra UTSW 13 112524135 missense probably benign 0.01
R5743:Il31ra UTSW 13 112527487 missense possibly damaging 0.89
R6126:Il31ra UTSW 13 112530374 missense probably damaging 1.00
R6414:Il31ra UTSW 13 112523907 missense possibly damaging 0.90
R6580:Il31ra UTSW 13 112551942 missense possibly damaging 0.90
R6727:Il31ra UTSW 13 112547368 missense probably damaging 1.00
R6783:Il31ra UTSW 13 112551988 critical splice acceptor site probably null
R6912:Il31ra UTSW 13 112549464 missense probably damaging 0.99
R6925:Il31ra UTSW 13 112527529 missense possibly damaging 0.56
R7187:Il31ra UTSW 13 112546311 missense probably benign 0.04
R7210:Il31ra UTSW 13 112549500 missense possibly damaging 0.95
R7236:Il31ra UTSW 13 112523905 makesense probably null
R7323:Il31ra UTSW 13 112551963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGCTCAACCCAGGAAGC -3'
(R):5'- AGTTTCTGTCACACAAACTTCCAAC -3'

Sequencing Primer
(F):5'- CCCTACACCAGAATAAGCAGATGAGG -3'
(R):5'- CTTCCAACTAGCAAAGGAAGAGG -3'
Posted On2017-02-28