Incidental Mutation 'R0565:Wbp2'
ID46143
Institutional Source Beutler Lab
Gene Symbol Wbp2
Ensembl Gene ENSMUSG00000034341
Gene NameWW domain binding protein 2
Synonyms
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0565 (G1)
Quality Score152
Status Validated
Chromosome11
Chromosomal Location116078573-116086995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116082385 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 65 (D65E)
Ref Sequence ENSEMBL: ENSMUSP00000102052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074628] [ENSMUST00000075036] [ENSMUST00000106444] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000156545] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074628
AA Change: D65E

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074204
Gene: ENSMUSG00000034341
AA Change: D65E

DomainStartEndE-ValueType
Pfam:GRAM 1 84 1.2e-19 PFAM
Pfam:WWbp 100 204 1.3e-20 PFAM
low complexity region 247 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075036
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106444
AA Change: D65E

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102052
Gene: ENSMUSG00000034341
AA Change: D65E

DomainStartEndE-ValueType
Pfam:GRAM 1 84 2.3e-19 PFAM
Pfam:WWbp 100 212 5.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106450
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106451
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155120
Predicted Effect probably benign
Transcript: ENSMUST00000156545
SMART Domains Protein: ENSMUSP00000118266
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174822
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein that is a transcriptional coactivator of estrogen receptor alpha and progesterone receptor. Defects in this gene have been associated with hearing impairment. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a null allele show progressive high-frequency hearing loss, raised auditory brainstem response (ABR) thresholds, reduced ABR amplitudes, swelling of afferent terminals, inner hair cell synapse defects, and altered expression of AMPA receptor subunits and post-synaptic proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Wbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Wbp2 APN 11 116081240 missense possibly damaging 0.46
R0006:Wbp2 UTSW 11 116079788 unclassified probably null
R1510:Wbp2 UTSW 11 116086882 missense probably benign 0.03
R1733:Wbp2 UTSW 11 116083883 missense probably benign 0.10
R1968:Wbp2 UTSW 11 116082365 missense possibly damaging 0.90
R1989:Wbp2 UTSW 11 116080221 critical splice donor site probably null
R2109:Wbp2 UTSW 11 116080619 nonsense probably null
R2264:Wbp2 UTSW 11 116079598 critical splice acceptor site probably null
R3079:Wbp2 UTSW 11 116079708 unclassified probably null
R4239:Wbp2 UTSW 11 116080547 unclassified probably benign
R4647:Wbp2 UTSW 11 116082381 missense probably benign 0.01
R4831:Wbp2 UTSW 11 116080637 nonsense probably null
R6146:Wbp2 UTSW 11 116083902 missense probably benign 0.07
R6367:Wbp2 UTSW 11 116083915 missense probably benign 0.36
R6455:Wbp2 UTSW 11 116079753 missense probably damaging 0.98
R6823:Wbp2 UTSW 11 116086910 missense probably benign 0.41
Z1088:Wbp2 UTSW 11 116086913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAAAGGGCGTTTCCAGGTGG -3'
(R):5'- AACCCAGGGGTTTTCCAGGTATGG -3'

Sequencing Primer
(F):5'- TTTCCAGGTGGCAGCCAG -3'
(R):5'- TGTCAGGCAAAGTGTGACCTAC -3'
Posted On2013-06-11