Incidental Mutation 'R5917:Proc'
ID461433
Institutional Source Beutler Lab
Gene Symbol Proc
Ensembl Gene ENSMUSG00000024386
Gene Nameprotein C
SynonymsPC, inactivator of coagulation factors Va, VIII
MMRRC Submission 044114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5917 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location32123129-32139570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32127460 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 204 (D204V)
Ref Sequence ENSEMBL: ENSMUSP00000132226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171765]
Predicted Effect probably benign
Transcript: ENSMUST00000171765
AA Change: D204V

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132226
Gene: ENSMUSG00000024386
AA Change: D204V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GLA 24 86 6.66e-30 SMART
EGF_CA 87 131 1.25e-6 SMART
EGF 138 175 3.62e-3 SMART
low complexity region 201 210 N/A INTRINSIC
Tryp_SPc 211 444 2.6e-82 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the vitamin K-dependent protein C, which plays a vital role in the anticoagulation pathway. The encoded protein undergoes proteolytic processing including activation by thrombin-thrombomodulin complex to form the anticoagulant serine protease that degrades activated coagulation factors. A complete lack of the encoded protein in mice results in severe perinatal consumptive coagulopathy in the brain and liver, resulting in death within 24 hours after birth. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Inactivation of the locus results in death within 24 hours of birth due to consumptive coagulopathy. Thromboses and bleeding are observed in the brains and livers of homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,334,681 F1500L probably damaging Het
Abcb5 T A 12: 118,868,781 R1153* probably null Het
Amdhd1 T C 10: 93,524,470 H409R possibly damaging Het
Anks1b C T 10: 90,576,941 probably benign Het
Ascc2 T C 11: 4,681,506 L649P probably benign Het
Chst15 A G 7: 132,270,517 F12L probably benign Het
Clec4a4 A T 6: 123,004,058 K83N probably benign Het
Comp T A 8: 70,376,361 probably null Het
Cryz T A 3: 154,621,766 S144T probably benign Het
Ctss A G 3: 95,543,113 D125G probably benign Het
Dact1 G T 12: 71,318,682 V746L possibly damaging Het
Dhx29 A G 13: 112,962,843 H1134R probably damaging Het
Dlgap4 A G 2: 156,704,540 D376G probably damaging Het
Dnah3 T A 7: 120,016,526 H1660L probably damaging Het
Ep300 T A 15: 81,628,607 probably benign Het
Fbxo30 A T 10: 11,289,518 probably null Het
Fcrls T A 3: 87,256,787 H345L probably damaging Het
Galnt11 C A 5: 25,247,672 probably null Het
Il31ra A G 13: 112,546,312 C87R probably benign Het
Itga4 A T 2: 79,287,098 Q416L probably damaging Het
Kcnt2 A T 1: 140,533,928 T806S probably damaging Het
Lama2 A G 10: 27,190,697 S1063P probably damaging Het
Lama4 T A 10: 39,048,032 S479T probably benign Het
Lgi4 C T 7: 31,060,178 T53M possibly damaging Het
Limk1 A G 5: 134,657,935 F533L probably damaging Het
Loxl1 A G 9: 58,312,723 L55P probably damaging Het
Map1a A G 2: 121,305,216 E1933G probably damaging Het
Matn2 T A 15: 34,409,766 C447* probably null Het
Mmrn1 T C 6: 60,973,150 probably null Het
Olfr1196 A T 2: 88,700,705 I208N possibly damaging Het
Olfr13 C T 6: 43,174,712 S242F probably damaging Het
Olfr464 A T 11: 87,914,389 N172K probably damaging Het
Otor A G 2: 143,078,511 I4M probably benign Het
P2rx3 A T 2: 85,035,247 V18E probably damaging Het
Pcdh7 T C 5: 57,721,755 V884A probably damaging Het
Pcdhb4 T A 18: 37,309,566 V643D probably damaging Het
Pelo A G 13: 115,089,394 S176P possibly damaging Het
Ppp2r3a A T 9: 101,211,984 V380E probably benign Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rtl1 T G 12: 109,591,653 T1251P possibly damaging Het
Sema6a T G 18: 47,281,338 I482L probably benign Het
Smpdl3a T A 10: 57,805,558 probably null Het
Strc T A 2: 121,379,309 M178L probably benign Het
Taok1 A T 11: 77,560,318 M312K probably damaging Het
Tle2 T C 10: 81,580,916 probably null Het
Tle3 A G 9: 61,408,908 D296G probably benign Het
Trank1 A G 9: 111,362,417 D498G probably benign Het
Vars C A 17: 35,012,515 L672M probably damaging Het
Vps13d G A 4: 145,100,010 T2866I probably damaging Het
Zfp423 C A 8: 87,782,232 E370* probably null Het
Zfp521 T A 18: 13,845,555 K600N probably damaging Het
Zfp788 A G 7: 41,649,148 K351E probably benign Het
Zfp963 A T 8: 69,742,860 probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Proc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Proc APN 18 32123513 missense probably benign 0.05
IGL01071:Proc APN 18 32123717 missense probably damaging 1.00
IGL01287:Proc APN 18 32123820 splice site probably benign
IGL01298:Proc APN 18 32123552 missense probably benign 0.01
IGL01898:Proc APN 18 32133145 critical splice donor site probably null
IGL01977:Proc APN 18 32127419 missense probably benign 0.02
IGL02040:Proc APN 18 32134860 missense probably benign 0.07
IGL02724:Proc APN 18 32134872 missense probably damaging 1.00
IGL02852:Proc APN 18 32125155 missense probably damaging 1.00
IGL02901:Proc APN 18 32123625 missense possibly damaging 0.89
IGL03401:Proc APN 18 32123273 missense possibly damaging 0.96
R0110:Proc UTSW 18 32125118 missense probably benign 0.26
R0131:Proc UTSW 18 32135898 missense probably benign 0.01
R0510:Proc UTSW 18 32125118 missense probably benign 0.26
R0988:Proc UTSW 18 32133483 missense probably benign
R1455:Proc UTSW 18 32123398 missense probably damaging 1.00
R1463:Proc UTSW 18 32133438 missense possibly damaging 0.69
R1546:Proc UTSW 18 32127410 missense probably damaging 1.00
R1711:Proc UTSW 18 32127406 missense probably benign 0.05
R3414:Proc UTSW 18 32123685 missense probably benign 0.00
R3911:Proc UTSW 18 32123705 missense probably damaging 1.00
R4276:Proc UTSW 18 32135914 missense probably benign 0.00
R4598:Proc UTSW 18 32123459 missense probably damaging 1.00
R4623:Proc UTSW 18 32127473 missense probably benign 0.32
R4758:Proc UTSW 18 32123810 missense probably damaging 0.97
R4941:Proc UTSW 18 32125113 missense possibly damaging 0.60
R6349:Proc UTSW 18 32133433 missense probably benign 0.00
R6636:Proc UTSW 18 32123760 missense probably benign 0.00
R6735:Proc UTSW 18 32123648 missense probably benign 0.01
R7110:Proc UTSW 18 32133388 missense probably benign 0.30
R7310:Proc UTSW 18 32135899 missense probably benign 0.03
R7409:Proc UTSW 18 32127460 missense probably benign 0.03
R7597:Proc UTSW 18 32123636 missense probably damaging 1.00
R7598:Proc UTSW 18 32135876 missense probably benign 0.00
R7604:Proc UTSW 18 32134778 intron probably null
R7738:Proc UTSW 18 32127479 nonsense probably null
X0021:Proc UTSW 18 32123507 missense probably damaging 0.96
Z1176:Proc UTSW 18 32134979 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATGCATGCCCTTCCCTGAC -3'
(R):5'- AACTCTTGCTAGTAGGTGGCAC -3'

Sequencing Primer
(F):5'- ACCATGCCCATTTCTATCCATACCAG -3'
(R):5'- CACTTCTTGAAGCGTCCAGGATG -3'
Posted On2017-02-28