Incidental Mutation 'R5918:Dnah7b'
ID461437
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5918 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46221643 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1987 (V1987A)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect probably benign
Transcript: ENSMUST00000069293
AA Change: V1987A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: V1987A

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Meta Mutation Damage Score 0.0882 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
BB001:Dnah7b UTSW 1 46219430 missense probably benign 0.04
BB011:Dnah7b UTSW 1 46219430 missense probably benign 0.04
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 splice site probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7486:Dnah7b UTSW 1 46290734 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46356554 missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46124346 missense probably benign 0.06
R7547:Dnah7b UTSW 1 46214413 missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46268634 missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46109302 missense probably benign
R7676:Dnah7b UTSW 1 46234164 nonsense probably null
R7731:Dnah7b UTSW 1 46139745 missense probably benign 0.00
R7760:Dnah7b UTSW 1 46201253 missense probably damaging 1.00
R7768:Dnah7b UTSW 1 46137474 missense probably benign
R7807:Dnah7b UTSW 1 46214367 missense probably benign
R7895:Dnah7b UTSW 1 46249950 missense probably damaging 1.00
R7911:Dnah7b UTSW 1 46139678 missense probably damaging 1.00
R7924:Dnah7b UTSW 1 46219430 missense probably benign 0.04
R7944:Dnah7b UTSW 1 46227003 missense probably benign
R7946:Dnah7b UTSW 1 46233579 missense probably damaging 1.00
R7983:Dnah7b UTSW 1 46243424 missense probably damaging 1.00
R8012:Dnah7b UTSW 1 46243365 missense probably damaging 1.00
R8069:Dnah7b UTSW 1 46224706 nonsense probably null
R8094:Dnah7b UTSW 1 46126804 missense probably benign 0.01
R8137:Dnah7b UTSW 1 46233753 missense probably damaging 1.00
R8167:Dnah7b UTSW 1 46253511 missense possibly damaging 0.95
R8268:Dnah7b UTSW 1 46356576 missense probably benign 0.43
R8309:Dnah7b UTSW 1 46139872 missense probably damaging 1.00
R8313:Dnah7b UTSW 1 46175296 missense possibly damaging 0.81
R8410:Dnah7b UTSW 1 46356659 critical splice donor site probably null
R8438:Dnah7b UTSW 1 46188679 missense probably damaging 1.00
R8446:Dnah7b UTSW 1 46290715 missense probably damaging 1.00
R8471:Dnah7b UTSW 1 46099490 missense possibly damaging 0.92
R8551:Dnah7b UTSW 1 46116200 missense possibly damaging 0.94
RF020:Dnah7b UTSW 1 46373261 missense possibly damaging 0.84
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACATGGGAGCGGAGTTTCTC -3'
(R):5'- CTTAAGACCCCATGAACGCTTTAAC -3'

Sequencing Primer
(F):5'- CAGACTGAGAGGATAATTAATTGTGC -3'
(R):5'- CCATGAACGCTTTAACCAAATTC -3'
Posted On2017-02-28