Incidental Mutation 'R5918:Ceacam3'
ID461461
Institutional Source Beutler Lab
Gene Symbol Ceacam3
Ensembl Gene ENSMUSG00000053228
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 3
SynonymsEG384557, cea12, Psg24
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5918 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17150282-17164253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 17159745 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 394 (D394Y)
Ref Sequence ENSEMBL: ENSMUSP00000104131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108491]
Predicted Effect probably damaging
Transcript: ENSMUST00000065540
AA Change: D394Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069892
Gene: ENSMUSG00000053228
AA Change: D394Y

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
IG 35 136 2.83e-3 SMART
IG 155 256 6.31e-1 SMART
IG 275 376 1.42e-3 SMART
IG 395 494 2.08e-1 SMART
IG 511 610 1.26e0 SMART
IGc2 628 692 7.64e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108491
AA Change: D394Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104131
Gene: ENSMUSG00000053228
AA Change: D394Y

DomainStartEndE-ValueType
IG 40 141 2.83e-3 SMART
IG 160 261 6.31e-1 SMART
IG 280 379 8.01e-3 SMART
IG 398 497 2.08e-1 SMART
IG 514 613 1.26e0 SMART
IGc2 631 695 7.64e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Ceacam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ceacam3 APN 7 17151857 missense probably benign 0.03
IGL01510:Ceacam3 APN 7 17159842 missense probably benign 0.00
IGL01830:Ceacam3 APN 7 17155000 missense possibly damaging 0.79
IGL02155:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02281:Ceacam3 APN 7 17161731 missense probably benign 0.43
IGL02301:Ceacam3 APN 7 17163101 missense probably damaging 1.00
IGL02320:Ceacam3 APN 7 17161940 missense probably benign 0.43
IGL02514:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02929:Ceacam3 APN 7 17158190 missense probably damaging 1.00
IGL03143:Ceacam3 APN 7 17158120 nonsense probably null
IGL03269:Ceacam3 APN 7 17161842 missense probably damaging 0.99
R0408:Ceacam3 UTSW 7 17151883 critical splice donor site probably benign
R0591:Ceacam3 UTSW 7 17151883 critical splice donor site probably null
R1274:Ceacam3 UTSW 7 17163139 missense probably damaging 0.98
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1490:Ceacam3 UTSW 7 17163146 missense probably damaging 1.00
R1635:Ceacam3 UTSW 7 17159977 missense probably damaging 1.00
R1769:Ceacam3 UTSW 7 17158376 missense probably damaging 1.00
R2345:Ceacam3 UTSW 7 17155000 missense possibly damaging 0.79
R2367:Ceacam3 UTSW 7 17151888 splice site probably null
R2403:Ceacam3 UTSW 7 17161854 missense probably damaging 1.00
R4030:Ceacam3 UTSW 7 17158342 missense probably benign 0.43
R4240:Ceacam3 UTSW 7 17160024 missense possibly damaging 0.95
R5305:Ceacam3 UTSW 7 17151576 missense probably damaging 1.00
R5314:Ceacam3 UTSW 7 17158371 missense possibly damaging 0.94
R5433:Ceacam3 UTSW 7 17159883 missense possibly damaging 0.48
R5538:Ceacam3 UTSW 7 17158421 missense probably damaging 1.00
R5638:Ceacam3 UTSW 7 17159935 missense probably damaging 0.98
R5787:Ceacam3 UTSW 7 17155046 missense possibly damaging 0.80
R5891:Ceacam3 UTSW 7 17151793 missense probably damaging 1.00
R6074:Ceacam3 UTSW 7 17151559 missense probably benign 0.05
R6386:Ceacam3 UTSW 7 17158219 missense probably benign 0.22
R6439:Ceacam3 UTSW 7 17158328 missense possibly damaging 0.59
R6455:Ceacam3 UTSW 7 17161938 missense possibly damaging 0.81
R7150:Ceacam3 UTSW 7 17151562 missense
R7196:Ceacam3 UTSW 7 17154956 missense
R7201:Ceacam3 UTSW 7 17158238 nonsense probably null
R7731:Ceacam3 UTSW 7 17158350 missense
R7833:Ceacam3 UTSW 7 17159853 missense
R7916:Ceacam3 UTSW 7 17159853 missense
Predicted Primers PCR Primer
(F):5'- TGCTGACTTCCACCAGGTTG -3'
(R):5'- GCAGCAGGGATCCATTGGTATAC -3'

Sequencing Primer
(F):5'- CTTCCACCAGGTTGGGTAGAAATG -3'
(R):5'- GCAGGGATCCATTGGTATACACTATC -3'
Posted On2017-02-28