Incidental Mutation 'R5918:Ccdc38'
ID461478
Institutional Source Beutler Lab
Gene Symbol Ccdc38
Ensembl Gene ENSMUSG00000036168
Gene Namecoiled-coil domain containing 38
Synonyms
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R5918 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location93540632-93584327 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 93570886 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 219 (Y219*)
Ref Sequence ENSEMBL: ENSMUSP00000150407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092215] [ENSMUST00000132214]
Predicted Effect probably null
Transcript: ENSMUST00000092215
AA Change: Y319*
SMART Domains Protein: ENSMUSP00000089860
Gene: ENSMUSG00000036168
AA Change: Y319*

DomainStartEndE-ValueType
Pfam:DUF4200 112 230 4.4e-28 PFAM
low complexity region 280 289 N/A INTRINSIC
low complexity region 317 333 N/A INTRINSIC
coiled coil region 388 412 N/A INTRINSIC
coiled coil region 479 522 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128786
Predicted Effect probably null
Transcript: ENSMUST00000132214
AA Change: Y219*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Ccdc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Ccdc38 APN 10 93569935 critical splice donor site probably null
IGL01986:Ccdc38 APN 10 93579843 missense probably damaging 1.00
IGL02396:Ccdc38 APN 10 93574132 missense possibly damaging 0.61
IGL02568:Ccdc38 APN 10 93579823 missense probably damaging 1.00
ANU23:Ccdc38 UTSW 10 93569935 critical splice donor site probably null
R0004:Ccdc38 UTSW 10 93574102 missense probably damaging 1.00
R0194:Ccdc38 UTSW 10 93565912 nonsense probably null
R0371:Ccdc38 UTSW 10 93562812 nonsense probably null
R1374:Ccdc38 UTSW 10 93582434 splice site probably benign
R1388:Ccdc38 UTSW 10 93581840 splice site probably benign
R1546:Ccdc38 UTSW 10 93565879 missense probably benign 0.01
R2377:Ccdc38 UTSW 10 93574035 missense probably damaging 1.00
R2419:Ccdc38 UTSW 10 93548975 missense probably benign 0.23
R3949:Ccdc38 UTSW 10 93550219 missense probably damaging 1.00
R5592:Ccdc38 UTSW 10 93550202 missense possibly damaging 0.58
R5652:Ccdc38 UTSW 10 93555586 splice site probably null
R5857:Ccdc38 UTSW 10 93562833 missense possibly damaging 0.67
R5919:Ccdc38 UTSW 10 93578838 missense possibly damaging 0.95
R6057:Ccdc38 UTSW 10 93581746 missense probably damaging 1.00
R6293:Ccdc38 UTSW 10 93562797 nonsense probably null
R7511:Ccdc38 UTSW 10 93562800 missense possibly damaging 0.92
R8006:Ccdc38 UTSW 10 93555586 splice site probably null
R8206:Ccdc38 UTSW 10 93563284 missense probably damaging 0.97
R8313:Ccdc38 UTSW 10 93563249 missense probably damaging 1.00
Z1177:Ccdc38 UTSW 10 93562876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCACCACTGGCTTCTTCATG -3'
(R):5'- ACAAGTATTGGCAATTGACAGG -3'

Sequencing Primer
(F):5'- ACAACTCAGGGGATCTGGCTTC -3'
(R):5'- TGGCAATTGACAGGATTTAAGAAC -3'
Posted On2017-02-28