Incidental Mutation 'R0565:Sel1l'
ID46148
Institutional Source Beutler Lab
Gene Symbol Sel1l
Ensembl Gene ENSMUSG00000020964
Gene Namesel-1 suppressor of lin-12-like (C. elegans)
SynonymsSel1h
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0565 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location91806043-91849157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91813945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 641 (V641L)
Ref Sequence ENSEMBL: ENSMUSP00000021347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021347] [ENSMUST00000167466] [ENSMUST00000178462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021347
AA Change: V641L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021347
Gene: ENSMUSG00000020964
AA Change: V641L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FN2 116 164 1.24e-24 SMART
SEL1 179 214 2.48e-1 SMART
SEL1 215 250 7.5e1 SMART
SEL1 251 286 1.86e-5 SMART
SEL1 287 322 1.16e-1 SMART
SEL1 369 405 7.93e-9 SMART
SEL1 406 442 8.05e-10 SMART
SEL1 443 478 2.48e-10 SMART
SEL1 479 514 1.91e-11 SMART
SEL1 515 550 9.04e-4 SMART
Pfam:Sel1 585 622 3.4e-1 PFAM
SEL1 623 658 4.42e-7 SMART
SEL1 660 695 2.28e-9 SMART
low complexity region 766 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166691
Predicted Effect possibly damaging
Transcript: ENSMUST00000167466
AA Change: V591L

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129384
Gene: ENSMUSG00000020964
AA Change: V591L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 534 572 1.5e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171465
Predicted Effect possibly damaging
Transcript: ENSMUST00000178462
AA Change: V591L

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136087
Gene: ENSMUSG00000020964
AA Change: V591L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SEL1 129 164 2.48e-1 SMART
SEL1 165 200 7.5e1 SMART
SEL1 201 236 1.86e-5 SMART
SEL1 237 272 1.16e-1 SMART
SEL1 319 355 7.93e-9 SMART
SEL1 356 392 8.05e-10 SMART
SEL1 393 428 2.48e-10 SMART
SEL1 429 464 1.91e-11 SMART
SEL1 465 500 9.04e-4 SMART
Pfam:Sel1 535 572 3.2e-1 PFAM
SEL1 573 608 4.42e-7 SMART
SEL1 610 645 2.28e-9 SMART
low complexity region 716 740 N/A INTRINSIC
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit prenatal lethality with impaired exocrine and endocrine pancreatic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Sel1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sel1l APN 12 91814613 splice site probably benign
IGL01082:Sel1l APN 12 91811908 missense probably benign 0.41
IGL01402:Sel1l APN 12 91841833 missense possibly damaging 0.55
IGL01610:Sel1l APN 12 91817290 missense probably damaging 1.00
IGL01690:Sel1l APN 12 91843259 missense probably benign
IGL01803:Sel1l APN 12 91830730 missense probably benign 0.37
IGL01939:Sel1l APN 12 91816247 missense probably damaging 1.00
IGL02275:Sel1l APN 12 91815015 missense probably damaging 1.00
IGL02279:Sel1l APN 12 91814997 missense probably damaging 1.00
IGL02407:Sel1l APN 12 91843268 splice site probably benign
IGL02934:Sel1l APN 12 91809936 nonsense probably null
R0533:Sel1l UTSW 12 91820094 missense probably damaging 1.00
R0565:Sel1l UTSW 12 91811889 missense probably benign 0.16
R0973:Sel1l UTSW 12 91824860 missense probably damaging 1.00
R1378:Sel1l UTSW 12 91833097 intron probably null
R1505:Sel1l UTSW 12 91813962 missense probably damaging 1.00
R1530:Sel1l UTSW 12 91826684 missense probably damaging 0.96
R2001:Sel1l UTSW 12 91826550 nonsense probably null
R3418:Sel1l UTSW 12 91810002 missense probably damaging 1.00
R3419:Sel1l UTSW 12 91810002 missense probably damaging 1.00
R4601:Sel1l UTSW 12 91833053 critical splice donor site probably null
R4776:Sel1l UTSW 12 91813893 missense probably damaging 1.00
R4839:Sel1l UTSW 12 91833158 missense probably benign 0.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4860:Sel1l UTSW 12 91831602 missense probably damaging 1.00
R4869:Sel1l UTSW 12 91814054 intron probably benign
R5261:Sel1l UTSW 12 91824884 missense possibly damaging 0.92
R5692:Sel1l UTSW 12 91811878 missense probably benign 0.02
R5744:Sel1l UTSW 12 91809980 missense possibly damaging 0.95
R5830:Sel1l UTSW 12 91833171 missense probably damaging 1.00
R6799:Sel1l UTSW 12 91814968 splice site probably null
R7291:Sel1l UTSW 12 91848965 missense probably benign
Z1176:Sel1l UTSW 12 91825297 missense not run
Predicted Primers PCR Primer
(F):5'- AGAATTCCAGAGGCACTGCTCTCC -3'
(R):5'- GTGAAGCAGCCCTGTCTTCTCTATG -3'

Sequencing Primer
(F):5'- GCATGTAGCCCAGGTTAAAC -3'
(R):5'- CTGTAACCTGCTTTCTGAGAAGAG -3'
Posted On2013-06-11