Incidental Mutation 'R5918:Pik3r6'
ID461481
Institutional Source Beutler Lab
Gene Symbol Pik3r6
Ensembl Gene ENSMUSG00000046207
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 044115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5918 (G1)
Quality Score154
Status Validated
Chromosome11
Chromosomal Location68503019-68552698 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 68525671 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 29 (Q29*)
Ref Sequence ENSEMBL: ENSMUSP00000099673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060441] [ENSMUST00000102613]
Predicted Effect probably null
Transcript: ENSMUST00000060441
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102613
AA Change: Q29*
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207
AA Change: Q29*

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153671
Meta Mutation Damage Score 0.9597 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
MGI Phenotype FUNCTION: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 11. The protein binds to both the catalytic subunit and to G beta-gamma, and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small reductions in lymphocyte and granulocyte and a slight increase in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Crip1 A C 12: 113,153,667 probably null Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Pik3r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Pik3r6 APN 11 68534251 missense probably damaging 0.98
IGL00913:Pik3r6 APN 11 68551321 missense probably damaging 1.00
IGL00984:Pik3r6 APN 11 68533619 missense probably benign 0.39
IGL01110:Pik3r6 APN 11 68528826 critical splice donor site probably null
IGL01116:Pik3r6 APN 11 68531450 missense probably benign 0.01
IGL02839:Pik3r6 APN 11 68526412 missense probably damaging 1.00
PIT4142001:Pik3r6 UTSW 11 68527105 missense probably damaging 1.00
R0044:Pik3r6 UTSW 11 68544750 missense probably benign 0.02
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0266:Pik3r6 UTSW 11 68526408 nonsense probably null
R0454:Pik3r6 UTSW 11 68528782 missense possibly damaging 0.88
R0906:Pik3r6 UTSW 11 68536101 splice site probably benign
R1119:Pik3r6 UTSW 11 68545872 missense probably benign 0.05
R1440:Pik3r6 UTSW 11 68531445 missense possibly damaging 0.91
R1664:Pik3r6 UTSW 11 68536106 missense probably benign
R1831:Pik3r6 UTSW 11 68544034 missense probably benign 0.26
R2144:Pik3r6 UTSW 11 68543611 nonsense probably null
R4013:Pik3r6 UTSW 11 68533521 missense possibly damaging 0.85
R4754:Pik3r6 UTSW 11 68544775 missense probably damaging 1.00
R4770:Pik3r6 UTSW 11 68529894 missense probably damaging 1.00
R4860:Pik3r6 UTSW 11 68544053 splice site probably benign
R4974:Pik3r6 UTSW 11 68539945 missense probably damaging 1.00
R5033:Pik3r6 UTSW 11 68533468 nonsense probably null
R5787:Pik3r6 UTSW 11 68539927 missense possibly damaging 0.54
R6164:Pik3r6 UTSW 11 68551973 missense probably benign 0.00
R6192:Pik3r6 UTSW 11 68543629 missense probably damaging 1.00
R6440:Pik3r6 UTSW 11 68533696 missense probably benign 0.09
R7699:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7700:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7922:Pik3r6 UTSW 11 68533875 missense probably benign 0.00
R7964:Pik3r6 UTSW 11 68533739 missense probably benign 0.01
R8515:Pik3r6 UTSW 11 68539957 missense probably damaging 1.00
W0251:Pik3r6 UTSW 11 68533871 missense probably benign 0.01
Z1088:Pik3r6 UTSW 11 68525602 missense probably damaging 0.98
Z1176:Pik3r6 UTSW 11 68520200 start gained probably benign
Z1176:Pik3r6 UTSW 11 68544765 missense probably benign 0.12
Z1177:Pik3r6 UTSW 11 68551227 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAATGTGCTGGTTGCCAACTC -3'
(R):5'- GAGAAGCCTTCCAAGTCCAC -3'

Sequencing Primer
(F):5'- CAACTCCTGATGGATTGCTACTGG -3'
(R):5'- GCCTTCCAAGTCCACAAGCAG -3'
Posted On2017-02-28