Incidental Mutation 'R5918:Crip1'
ID461488
Institutional Source Beutler Lab
Gene Symbol Crip1
Ensembl Gene ENSMUSG00000006360
Gene Namecysteine-rich protein 1 (intestinal)
SynonymsCRP1, Crip
MMRRC Submission 044115-MU
Accession Numbers

Ncbi RefSeq: NM_007763.3; MGI:88501

Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R5918 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113146316-113153879 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to C at 113153667 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006523] [ENSMUST00000049271] [ENSMUST00000196755] [ENSMUST00000199089] [ENSMUST00000200522] [ENSMUST00000200553]
Predicted Effect probably null
Transcript: ENSMUST00000006523
SMART Domains Protein: ENSMUSP00000006523
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049271
SMART Domains Protein: ENSMUSP00000035351
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DUF4509 41 221 4.8e-65 PFAM
low complexity region 233 245 N/A INTRINSIC
Pfam:DUF4510 258 418 3.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196505
Predicted Effect probably benign
Transcript: ENSMUST00000196755
SMART Domains Protein: ENSMUSP00000143431
Gene: ENSMUSG00000037466

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:DUF4509 40 138 4.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198909
Predicted Effect probably null
Transcript: ENSMUST00000199089
SMART Domains Protein: ENSMUSP00000142803
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 54 106 9.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199382
Predicted Effect probably benign
Transcript: ENSMUST00000200522
Predicted Effect probably benign
Transcript: ENSMUST00000200553
SMART Domains Protein: ENSMUSP00000143680
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.6%
Validation Efficiency 93% (66/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cysteine-rich intestinal protein (CRIP) belongs to the LIM/double zinc finger protein family, members of which include cysteine- and glycine-rich protein-1 (CSRP1; MIM 123876), rhombotin-1 (RBTN1; MIM 186921), rhombotin-2 (RBTN2; MIM 180385), and rhombotin-3 (RBTN3; MIM 180386). CRIP may be involved in intestinal zinc transport (Hempe and Cousins, 1991 [PubMed 1946385]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(8) : Targeted(2) Gene trapped(6)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 A T 5: 35,974,525 I399F possibly damaging Het
Aknad1 C T 3: 108,752,387 P239L probably benign Het
Ankrd9 A G 12: 110,976,766 V245A probably benign Het
Anxa1 T C 19: 20,378,493 probably benign Het
Arhgef2 A G 3: 88,636,080 K454R probably damaging Het
AU040320 A G 4: 126,814,271 T227A probably benign Het
Bbs2 C T 8: 94,098,303 R17H probably damaging Het
Bcl2l12 A G 7: 44,991,464 probably benign Het
C1qtnf9 G T 14: 60,772,288 probably benign Het
Ccdc38 C G 10: 93,570,886 Y219* probably null Het
Ceacam3 G T 7: 17,159,745 D394Y probably damaging Het
Dnah7b T C 1: 46,221,643 V1987A probably benign Het
Dnah9 C A 11: 65,834,199 C4376F probably damaging Het
Fam71f2 A G 6: 29,285,943 R76G probably null Het
Galnt9 T C 5: 110,615,466 F446L probably damaging Het
Gm14322 A G 2: 177,769,706 D103G probably benign Het
Gpa33 T C 1: 166,130,538 probably null Het
Lactb2 T A 1: 13,650,730 I93F probably benign Het
Lifr A T 15: 7,159,416 T93S probably benign Het
Lmbr1l A T 15: 98,912,427 I101N probably damaging Het
Lrrc8c G A 5: 105,608,251 V631M possibly damaging Het
Mctp2 A C 7: 72,228,540 D263E probably damaging Het
Nbeal1 T A 1: 60,267,892 I1627N possibly damaging Het
Neb T C 2: 52,197,894 Y5188C probably damaging Het
Nf1 T C 11: 79,569,222 probably benign Het
Nr6a1 T C 2: 38,739,091 D250G probably damaging Het
Ola1 T C 2: 73,156,784 E168G probably benign Het
Olfr1505 T A 19: 13,919,775 F252I probably damaging Het
Olfr403 T C 11: 74,196,118 V205A probably damaging Het
Olfr715b T A 7: 107,106,621 Q80L probably damaging Het
Olfr730 A G 14: 50,186,968 I83T probably benign Het
Olfr837 T C 9: 19,137,388 Y132H probably damaging Het
Pik3r6 C T 11: 68,525,671 Q29* probably null Het
Ppargc1a C T 5: 51,463,237 probably benign Het
Ppl C T 16: 5,104,901 R242H probably benign Het
Ppp1r37 G T 7: 19,532,111 Q577K probably benign Het
Prcd A G 11: 116,657,540 E25G probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Ptgs1 A C 2: 36,251,077 E512A probably damaging Het
Radil T G 5: 142,487,602 I535L probably benign Het
Rbl2 G T 8: 91,090,130 V373F probably benign Het
Ryr1 T C 7: 29,009,152 Y4802C probably benign Het
Sdc2 A G 15: 33,028,167 T144A probably benign Het
Senp6 T C 9: 80,114,116 probably null Het
Sipa1l3 T C 7: 29,397,206 D531G probably damaging Het
Slc22a27 C A 19: 7,910,046 C189F possibly damaging Het
Srcin1 T C 11: 97,533,497 probably null Het
Svep1 C T 4: 58,069,345 E2814K possibly damaging Het
Tjp3 T G 10: 81,277,912 H504P probably benign Het
Tmprss4 T A 9: 45,175,116 K378* probably null Het
Tns4 C T 11: 99,073,671 probably null Het
Ttn T C 2: 76,749,954 T15205A possibly damaging Het
Ush2a G T 1: 188,356,814 G322V probably benign Het
Vac14 A T 8: 110,636,472 probably null Het
Vmn1r175 T G 7: 23,808,947 D85A probably damaging Het
Vmn2r93 T C 17: 18,325,768 L634P probably damaging Het
Zeb2 A T 2: 45,111,259 probably benign Het
Zfp616 T A 11: 74,083,260 H118Q possibly damaging Het
Zfp945 T A 17: 22,850,981 H648L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Crip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Crip1 APN 12 113152135 missense probably damaging 1.00
IGL00562:Crip1 APN 12 113153612 splice site probably null
IGL00563:Crip1 APN 12 113153612 splice site probably null
R0030:Crip1 UTSW 12 113153376 critical splice donor site probably null
R1879:Crip1 UTSW 12 113153332 missense probably damaging 1.00
R4542:Crip1 UTSW 12 113153489 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAAGCCCTACTGCAATC -3'
(R):5'- TTAAAGGCACTGAGGGTTCC -3'

Sequencing Primer
(F):5'- GCTACTCCGCCATGTTTGGG -3'
(R):5'- ACTGAGGGTTCCCGAGAG -3'
Posted On2017-02-28