Incidental Mutation 'R0565:Cd180'
ID46150
Institutional Source Beutler Lab
Gene Symbol Cd180
Ensembl Gene ENSMUSG00000021624
Gene NameCD180 antigen
SynonymsLy78, RP105
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0565 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102693558-102739629 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 102702874 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]
Predicted Effect probably benign
Transcript: ENSMUST00000022124
SMART Domains Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 76 99 1.07e0 SMART
LRR 193 221 1.76e2 SMART
LRR 297 320 1.66e1 SMART
Pfam:LRR_8 321 382 4.2e-13 PFAM
LRR 395 418 3e1 SMART
LRR 444 467 3.09e1 SMART
LRR 495 518 4.97e0 SMART
LRR 519 542 2.4e1 SMART
low complexity region 555 567 N/A INTRINSIC
LRRCT 577 626 5.11e-8 SMART
transmembrane domain 628 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167144
SMART Domains Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171267
SMART Domains Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 2e-38 PDB
SCOP:d1m0za_ 35 84 9e-4 SMART
Blast:LRR 51 75 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Cd180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cd180 APN 13 102705409 missense probably benign
IGL00949:Cd180 APN 13 102693760 missense possibly damaging 0.89
IGL01864:Cd180 APN 13 102706033 missense possibly damaging 0.93
IGL01901:Cd180 APN 13 102706428 missense probably benign 0.04
IGL01934:Cd180 APN 13 102702858 missense probably damaging 1.00
IGL01998:Cd180 APN 13 102705214 missense probably damaging 0.99
IGL02336:Cd180 APN 13 102705313 missense probably damaging 0.98
IGL03031:Cd180 APN 13 102705027 missense probably benign 0.00
IGL03139:Cd180 APN 13 102706416 missense probably damaging 1.00
Volte_face UTSW 13 102704923 missense probably damaging 0.99
H8562:Cd180 UTSW 13 102705418 missense probably benign 0.02
R0004:Cd180 UTSW 13 102702708 missense probably benign 0.00
R0393:Cd180 UTSW 13 102705900 missense probably damaging 0.99
R1080:Cd180 UTSW 13 102706220 nonsense probably null
R1223:Cd180 UTSW 13 102706222 missense possibly damaging 0.49
R1669:Cd180 UTSW 13 102705490 missense probably damaging 1.00
R1772:Cd180 UTSW 13 102706242 missense probably benign 0.11
R1784:Cd180 UTSW 13 102705859 missense probably damaging 1.00
R1865:Cd180 UTSW 13 102706009 missense probably benign
R2252:Cd180 UTSW 13 102706398 nonsense probably null
R2385:Cd180 UTSW 13 102705183 missense probably benign 0.00
R4653:Cd180 UTSW 13 102704908 missense probably damaging 1.00
R4695:Cd180 UTSW 13 102705760 missense probably benign 0.01
R4790:Cd180 UTSW 13 102702822 missense probably damaging 0.98
R4934:Cd180 UTSW 13 102739164 critical splice acceptor site probably null
R5052:Cd180 UTSW 13 102704895 missense probably benign
R5154:Cd180 UTSW 13 102705774 missense probably damaging 1.00
R5469:Cd180 UTSW 13 102704834 missense probably benign 0.37
R5493:Cd180 UTSW 13 102706141 missense probably benign 0.07
R5615:Cd180 UTSW 13 102706203 missense probably benign 0.34
R5905:Cd180 UTSW 13 102706033 missense possibly damaging 0.93
R6282:Cd180 UTSW 13 102693757 missense possibly damaging 0.90
R6433:Cd180 UTSW 13 102705633 missense probably benign 0.00
R6456:Cd180 UTSW 13 102702836 missense probably damaging 1.00
R6784:Cd180 UTSW 13 102702705 missense probably damaging 0.97
R6815:Cd180 UTSW 13 102705429 missense probably damaging 1.00
R6838:Cd180 UTSW 13 102702731 missense probably benign 0.38
R6941:Cd180 UTSW 13 102706191 missense probably benign 0.23
R7048:Cd180 UTSW 13 102704923 missense probably damaging 0.99
R7338:Cd180 UTSW 13 102706428 missense probably benign 0.04
R7466:Cd180 UTSW 13 102704995 missense probably damaging 1.00
R7647:Cd180 UTSW 13 102705943 missense probably damaging 1.00
Z1176:Cd180 UTSW 13 102705766 missense probably damaging 1.00
Z1177:Cd180 UTSW 13 102706032 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCTTCTCCCATCAGAAAGAAGTCAAC -3'
(R):5'- GTGACAGCCAACTCTATTAACAGGCAG -3'

Sequencing Primer
(F):5'- GAAGTCAACAAAACATACAACTGTG -3'
(R):5'- cccacaggatgagaaccac -3'
Posted On2013-06-11