Incidental Mutation 'R5920:Usp33'
ID461510
Institutional Source Beutler Lab
Gene Symbol Usp33
Ensembl Gene ENSMUSG00000025437
Gene Nameubiquitin specific peptidase 33
SynonymsVdu1, 9830169D19Rik
MMRRC Submission 044117-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R5920 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152346478-152393617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 152374683 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 484 (A484S)
Ref Sequence ENSEMBL: ENSMUSP00000026507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026507] [ENSMUST00000117492] [ENSMUST00000123237] [ENSMUST00000197748]
Predicted Effect probably damaging
Transcript: ENSMUST00000026507
AA Change: A484S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026507
Gene: ENSMUSG00000025437
AA Change: A484S

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 671 2.2e-71 PFAM
Pfam:UCH_1 154 387 1.4e-9 PFAM
Pfam:UCH_1 371 653 6.8e-25 PFAM
DUSP 691 774 4.4e-17 SMART
DUSP 799 883 2.44e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117492
AA Change: A484S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113265
Gene: ENSMUSG00000025437
AA Change: A484S

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 1.6e-64 PFAM
Pfam:UCH_1 154 387 1.2e-8 PFAM
Pfam:UCH_1 366 661 1.3e-23 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123237
SMART Domains Protein: ENSMUSP00000117590
Gene: ENSMUSG00000025437

DomainStartEndE-ValueType
PDB:2UZG|A 5 45 2e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000197600
Predicted Effect possibly damaging
Transcript: ENSMUST00000197748
AA Change: A484S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142708
Gene: ENSMUSG00000025437
AA Change: A484S

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 1.7e-18 PFAM
low complexity region 136 148 N/A INTRINSIC
Pfam:UCH 153 679 2.3e-71 PFAM
Pfam:UCH_1 154 383 1.2e-9 PFAM
Pfam:UCH_1 368 661 1e-24 PFAM
DUSP 699 782 4.4e-17 SMART
DUSP 807 891 2.44e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198950
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Chd2 A G 7: 73,537,312 L33P probably damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Dcdc2c T C 12: 28,535,537 I154V possibly damaging Het
Eif2b5 G T 16: 20,498,944 A11S unknown Het
Fam105a T A 15: 27,664,356 R109S possibly damaging Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mast3 T C 8: 70,787,933 I287V probably benign Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Olfr517 C A 7: 108,868,688 M155I probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Phykpl A C 11: 51,602,795 E453A probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Usp33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Usp33 APN 3 152373409 missense probably benign 0.00
IGL01085:Usp33 APN 3 152368569 missense possibly damaging 0.89
IGL01335:Usp33 APN 3 152392217 missense probably damaging 0.99
IGL02095:Usp33 APN 3 152381794 missense possibly damaging 0.94
IGL02323:Usp33 APN 3 152370387 missense probably benign
IGL03010:Usp33 APN 3 152368596 missense probably benign 0.04
R0464:Usp33 UTSW 3 152376235 splice site probably benign
R0576:Usp33 UTSW 3 152384119 nonsense probably null
R0583:Usp33 UTSW 3 152368254 missense probably damaging 1.00
R0715:Usp33 UTSW 3 152380574 missense probably damaging 1.00
R1445:Usp33 UTSW 3 152368634 missense probably damaging 0.99
R1507:Usp33 UTSW 3 152374763 missense possibly damaging 0.84
R1600:Usp33 UTSW 3 152379610 missense probably damaging 0.98
R1673:Usp33 UTSW 3 152368282 missense probably damaging 1.00
R1945:Usp33 UTSW 3 152379586 missense probably benign 0.07
R1961:Usp33 UTSW 3 152380628 missense probably damaging 1.00
R1973:Usp33 UTSW 3 152360286 missense possibly damaging 0.64
R2231:Usp33 UTSW 3 152373386 missense probably benign 0.00
R2299:Usp33 UTSW 3 152374621 missense probably damaging 0.99
R3001:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3002:Usp33 UTSW 3 152357942 missense probably damaging 0.99
R3923:Usp33 UTSW 3 152374791 critical splice donor site probably null
R4366:Usp33 UTSW 3 152368512 missense probably benign 0.44
R4821:Usp33 UTSW 3 152358673 missense probably benign 0.00
R5256:Usp33 UTSW 3 152391696 nonsense probably null
R5396:Usp33 UTSW 3 152384187 missense possibly damaging 0.77
R5445:Usp33 UTSW 3 152374623 missense probably damaging 1.00
R5877:Usp33 UTSW 3 152379476 missense possibly damaging 0.91
R5877:Usp33 UTSW 3 152379596 missense probably damaging 1.00
R5884:Usp33 UTSW 3 152368330 missense probably benign
R5913:Usp33 UTSW 3 152380592 missense probably damaging 1.00
R6331:Usp33 UTSW 3 152376250 missense probably damaging 1.00
R6516:Usp33 UTSW 3 152373416 missense probably benign 0.01
R6624:Usp33 UTSW 3 152381798 missense probably damaging 1.00
R6679:Usp33 UTSW 3 152368487 missense possibly damaging 0.46
R7196:Usp33 UTSW 3 152384191 missense possibly damaging 0.87
R7250:Usp33 UTSW 3 152392362 nonsense probably null
R7310:Usp33 UTSW 3 152360389 nonsense probably null
R7569:Usp33 UTSW 3 152391665 missense probably damaging 1.00
R7644:Usp33 UTSW 3 152357952 missense possibly damaging 0.47
X0025:Usp33 UTSW 3 152366758 missense probably damaging 1.00
X0058:Usp33 UTSW 3 152360346 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCTGAGCTGCAGGAGTAC -3'
(R):5'- CTAGTACAGCAGAAGCAGCAGC -3'

Sequencing Primer
(F):5'- ATCTCTGAGCTGCAGGAGTACTAATG -3'
(R):5'- GCAGCAGCATCAACATCAATG -3'
Posted On2017-02-28