Incidental Mutation 'R5920:Mast3'
ID461528
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 044117-MU
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5920 (G1)
Quality Score88
Status Not validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70787933 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 287 (I287V)
Ref Sequence ENSEMBL: ENSMUSP00000128703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
Predicted Effect probably benign
Transcript: ENSMUST00000166004
AA Change: I287V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I287V

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably benign
Transcript: ENSMUST00000211948
AA Change: I271V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T A 1: 37,637,981 K40M probably damaging Het
Adam18 T C 8: 24,674,075 K31E probably damaging Het
Ak9 T A 10: 41,420,676 C1473S probably benign Het
Aox1 T C 1: 58,049,472 L139S probably damaging Het
Arhgap45 T A 10: 80,029,131 V849D possibly damaging Het
Atp13a1 G A 8: 69,800,096 E689K probably benign Het
Calcr G A 6: 3,722,994 R11W probably damaging Het
Casd1 T A 6: 4,641,853 L710Q probably null Het
Cenpc1 T A 5: 86,020,910 T743S probably benign Het
Cfap43 A G 19: 47,760,896 V1185A possibly damaging Het
Chd2 A G 7: 73,537,312 L33P probably damaging Het
Col24a1 G T 3: 145,428,230 G889C probably damaging Het
Dbh T C 2: 27,177,231 probably benign Het
Dcdc2c T C 12: 28,535,537 I154V possibly damaging Het
Eif2b5 G T 16: 20,498,944 A11S unknown Het
Fam105a T A 15: 27,664,356 R109S possibly damaging Het
Frmd4a T G 2: 4,333,116 N44K probably benign Het
Fsip2 C T 2: 82,988,508 Q4862* probably null Het
Hectd4 C T 5: 121,308,271 T1513I possibly damaging Het
Hspg2 A T 4: 137,553,782 D3355V probably damaging Het
Il16 G A 7: 83,652,344 T190I probably benign Het
Immt T A 6: 71,863,196 V319D probably benign Het
Kdm2b G C 5: 122,880,296 S989W probably damaging Het
Kmt2e A G 5: 23,499,442 E1211G possibly damaging Het
Ktn1 G T 14: 47,724,024 G1061* probably null Het
Mrgpre T A 7: 143,781,728 T13S probably benign Het
Myoc C T 1: 162,639,559 A99V probably benign Het
Olfr517 C A 7: 108,868,688 M155I probably benign Het
Per3 G A 4: 151,012,450 P873S probably benign Het
Phykpl A C 11: 51,602,795 E453A probably benign Het
Pkd2l2 A T 18: 34,430,773 I514L probably benign Het
Plcl2 G T 17: 50,608,675 R904L probably damaging Het
Ptpn1 A G 2: 167,971,748 D137G probably benign Het
Rasal3 G A 17: 32,395,169 P571S probably damaging Het
Sdha A G 13: 74,326,925 probably null Het
Tbc1d31 C A 15: 57,942,558 Q439K probably benign Het
Ttc12 T C 9: 49,453,333 D381G possibly damaging Het
Ttc26 A G 6: 38,412,070 Y430C probably damaging Het
Uaca T A 9: 60,869,603 M424K probably benign Het
Usp33 G T 3: 152,374,683 A484S probably damaging Het
Usp9y A G Y: 1,316,730 S1940P probably damaging Het
Zfp532 G A 18: 65,644,350 V893I probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGATGGTAGAATTCTTCCGGG -3'
(R):5'- TCCTGGAGATGCAGGACAAG -3'

Sequencing Primer
(F):5'- GGTAGAATTCTTCCGGGTCAAACTC -3'
(R):5'- CAAGCTGGAGAGGCTGTTGC -3'
Posted On2017-02-28