Mutagenetix > Incidental Mutation

Incidental Mutation 'R5920:Mast3'

461528

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

044117-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5920 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70787933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 287 (I287V)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: I287V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I287V

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: I271V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.4%
20x: 92.4%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	T	A	1: 37,637,981	K40M	probably damaging	Het
Adam18	T	C	8: 24,674,075	K31E	probably damaging	Het
Ak9	T	A	10: 41,420,676	C1473S	probably benign	Het
Aox1	T	C	1: 58,049,472	L139S	probably damaging	Het
Arhgap45	T	A	10: 80,029,131	V849D	possibly damaging	Het
Atp13a1	G	A	8: 69,800,096	E689K	probably benign	Het
Calcr	G	A	6: 3,722,994	R11W	probably damaging	Het
Casd1	T	A	6: 4,641,853	L710Q	probably null	Het
Cenpc1	T	A	5: 86,020,910	T743S	probably benign	Het
Cfap43	A	G	19: 47,760,896	V1185A	possibly damaging	Het
Chd2	A	G	7: 73,537,312	L33P	probably damaging	Het
Col24a1	G	T	3: 145,428,230	G889C	probably damaging	Het
Dbh	T	C	2: 27,177,231		probably benign	Het
Dcdc2c	T	C	12: 28,535,537	I154V	possibly damaging	Het
Eif2b5	G	T	16: 20,498,944	A11S	unknown	Het
Fam105a	T	A	15: 27,664,356	R109S	possibly damaging	Het
Frmd4a	T	G	2: 4,333,116	N44K	probably benign	Het
Fsip2	C	T	2: 82,988,508	Q4862*	probably null	Het
Hectd4	C	T	5: 121,308,271	T1513I	possibly damaging	Het
Hspg2	A	T	4: 137,553,782	D3355V	probably damaging	Het
Il16	G	A	7: 83,652,344	T190I	probably benign	Het
Immt	T	A	6: 71,863,196	V319D	probably benign	Het
Kdm2b	G	C	5: 122,880,296	S989W	probably damaging	Het
Kmt2e	A	G	5: 23,499,442	E1211G	possibly damaging	Het
Ktn1	G	T	14: 47,724,024	G1061*	probably null	Het
Mrgpre	T	A	7: 143,781,728	T13S	probably benign	Het
Myoc	C	T	1: 162,639,559	A99V	probably benign	Het
Olfr517	C	A	7: 108,868,688	M155I	probably benign	Het
Per3	G	A	4: 151,012,450	P873S	probably benign	Het
Phykpl	A	C	11: 51,602,795	E453A	probably benign	Het
Pkd2l2	A	T	18: 34,430,773	I514L	probably benign	Het
Plcl2	G	T	17: 50,608,675	R904L	probably damaging	Het
Ptpn1	A	G	2: 167,971,748	D137G	probably benign	Het
Rasal3	G	A	17: 32,395,169	P571S	probably damaging	Het
Sdha	A	G	13: 74,326,925		probably null	Het
Tbc1d31	C	A	15: 57,942,558	Q439K	probably benign	Het
Ttc12	T	C	9: 49,453,333	D381G	possibly damaging	Het
Ttc26	A	G	6: 38,412,070	Y430C	probably damaging	Het
Uaca	T	A	9: 60,869,603	M424K	probably benign	Het
Usp33	G	T	3: 152,374,683	A484S	probably damaging	Het
Usp9y	A	G	Y: 1,316,730	S1940P	probably damaging	Het
Zfp532	G	A	18: 65,644,350	V893I	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGATGGTAGAATTCTTCCGGG -3'
(R):5'- TCCTGGAGATGCAGGACAAG -3'

Sequencing Primer
(F):5'- GGTAGAATTCTTCCGGGTCAAACTC -3'
(R):5'- CAAGCTGGAGAGGCTGTTGC -3'

Posted On

2017-02-28