Incidental Mutation 'R5921:Lrig2'
ID461560
Institutional Source Beutler Lab
Gene Symbol Lrig2
Ensembl Gene ENSMUSG00000032913
Gene Nameleucine-rich repeats and immunoglobulin-like domains 2
Synonyms4632419I10Rik
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location104396418-104511918 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 104462754 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 496 (L496*)
Ref Sequence ENSEMBL: ENSMUSP00000142373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046316] [ENSMUST00000198332] [ENSMUST00000199070]
Predicted Effect probably null
Transcript: ENSMUST00000046316
AA Change: L861*
SMART Domains Protein: ENSMUSP00000035999
Gene: ENSMUSG00000032913
AA Change: L861*

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197018
Predicted Effect probably null
Transcript: ENSMUST00000198332
AA Change: L854*
SMART Domains Protein: ENSMUSP00000142540
Gene: ENSMUSG00000032913
AA Change: L854*

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
LRR 118 141 3.56e2 SMART
LRR 142 165 1.81e2 SMART
LRR 167 188 1.31e0 SMART
LRR 213 236 1.41e0 SMART
LRR 237 260 4.98e-1 SMART
LRR 261 284 1.49e1 SMART
LRR 285 308 1.62e0 SMART
LRR 309 332 2.14e0 SMART
LRR_TYP 333 356 2.2e-2 SMART
LRR 357 383 9.22e0 SMART
LRR 384 407 2.17e-1 SMART
LRR_TYP 408 431 3.95e-4 SMART
LRRCT 442 492 3.62e-8 SMART
IG 503 598 2.19e-9 SMART
IGc2 613 681 1.94e-10 SMART
IGc2 707 772 3.2e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199070
AA Change: L496*
SMART Domains Protein: ENSMUSP00000142373
Gene: ENSMUSG00000032913
AA Change: L496*

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
LRRCT 84 134 1.8e-10 SMART
IG 145 240 9.2e-12 SMART
IGc2 255 323 8.1e-13 SMART
IGc2 349 414 1.3e-13 SMART
transmembrane domain 447 469 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200453
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing leucine-rich repeats and immunoglobulin-like domains. The encoded protein promotes epidermal growth factor signalling, resulting in increased proliferation. Its expression in the cytoplasm of glioma cells is correlated with poor survival. Mutations in this gene can cause urofacial syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to PDGFB-induced glioma and premature death due to illness with reduced body weight, letahrgy, hackled fur, crouched posture and increased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Lrig2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Lrig2 APN 3 104467171 missense probably damaging 0.99
IGL00715:Lrig2 APN 3 104463948 missense probably damaging 1.00
IGL01105:Lrig2 APN 3 104464168 nonsense probably null
IGL01767:Lrig2 APN 3 104491545 missense probably benign 0.12
IGL02080:Lrig2 APN 3 104464124 missense probably damaging 1.00
IGL02088:Lrig2 APN 3 104467108 missense probably damaging 1.00
IGL02967:Lrig2 APN 3 104494196 intron probably benign
IGL03024:Lrig2 APN 3 104494073 missense probably damaging 1.00
IGL03079:Lrig2 APN 3 104490971 missense probably damaging 0.98
IGL03085:Lrig2 APN 3 104467259 missense probably damaging 1.00
IGL03162:Lrig2 APN 3 104464297 missense probably damaging 1.00
Belladonna UTSW 3 104467366 splice site probably benign
R0414:Lrig2 UTSW 3 104494056 critical splice donor site probably null
R0866:Lrig2 UTSW 3 104464275 missense probably benign 0.00
R1184:Lrig2 UTSW 3 104490911 missense possibly damaging 0.94
R1524:Lrig2 UTSW 3 104463876 missense probably benign 0.38
R1606:Lrig2 UTSW 3 104480107 critical splice donor site probably null
R1672:Lrig2 UTSW 3 104491812 missense probably damaging 1.00
R1701:Lrig2 UTSW 3 104494677 missense probably benign 0.02
R1778:Lrig2 UTSW 3 104467366 splice site probably benign
R2034:Lrig2 UTSW 3 104494092 missense probably benign
R2100:Lrig2 UTSW 3 104511630 missense possibly damaging 0.76
R2186:Lrig2 UTSW 3 104468598 missense probably benign 0.00
R3778:Lrig2 UTSW 3 104457961 missense probably benign
R3977:Lrig2 UTSW 3 104457844 missense probably damaging 1.00
R4119:Lrig2 UTSW 3 104467195 missense probably benign 0.00
R4210:Lrig2 UTSW 3 104467304 missense probably benign 0.00
R4612:Lrig2 UTSW 3 104462783 missense probably damaging 1.00
R4872:Lrig2 UTSW 3 104491526 missense possibly damaging 0.66
R5020:Lrig2 UTSW 3 104457901 missense possibly damaging 0.71
R5499:Lrig2 UTSW 3 104461557 missense probably benign 0.00
R5687:Lrig2 UTSW 3 104464072 unclassified probably null
R5718:Lrig2 UTSW 3 104468615 nonsense probably null
R5886:Lrig2 UTSW 3 104462698 missense probably benign 0.01
R6434:Lrig2 UTSW 3 104491547 missense possibly damaging 0.91
R6468:Lrig2 UTSW 3 104467193 missense probably damaging 1.00
R6513:Lrig2 UTSW 3 104465729 missense probably damaging 1.00
R6675:Lrig2 UTSW 3 104457935 missense probably benign 0.35
R7243:Lrig2 UTSW 3 104497567 splice site probably null
R7395:Lrig2 UTSW 3 104497520 missense probably benign 0.00
R7444:Lrig2 UTSW 3 104497513 nonsense probably null
R7514:Lrig2 UTSW 3 104465760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGCCTTCTCTGGTTAAGAC -3'
(R):5'- GGTCCCAAGTCCATACCATTTC -3'

Sequencing Primer
(F):5'- TATTGCCCAGGCTAATGGAG -3'
(R):5'- TTTCCAGGCCAGTGTCAAAG -3'
Posted On2017-02-28