Incidental Mutation 'R5921:Aqp7'
ID461561
Institutional Source Beutler Lab
Gene Symbol Aqp7
Ensembl Gene ENSMUSG00000028427
Gene Nameaquaporin 7
SynonymsAQPap, AQP7L
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5921 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41033074-41048139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41036093 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 48 (N48K)
Ref Sequence ENSEMBL: ENSMUSP00000093007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030136] [ENSMUST00000054945]
Predicted Effect probably benign
Transcript: ENSMUST00000030136
AA Change: N48K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030136
Gene: ENSMUSG00000028427
AA Change: N48K

DomainStartEndE-ValueType
Pfam:MIP 12 257 7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054945
AA Change: N48K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093007
Gene: ENSMUSG00000028427
AA Change: N48K

DomainStartEndE-ValueType
Pfam:MIP 12 257 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149517
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice for one allele show decreased circulating glycerol levels and fasting hypoglycemia. Other mutant alleles show increased gonadal fat pad mass and adipocyte hypertrophy or increased urine glucose and impaired water permeability in the kidney, but have normal serum glycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Ipo13 A C 4: 117,912,089 L169V probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Aqp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Aqp7 APN 4 41045321 nonsense probably null
IGL01871:Aqp7 APN 4 41045321 nonsense probably null
IGL02173:Aqp7 APN 4 41034379 nonsense probably null
IGL03139:Aqp7 APN 4 41045326 missense probably benign 0.00
IGL03237:Aqp7 APN 4 41034884 missense possibly damaging 0.68
IGL03241:Aqp7 APN 4 41045270 splice site probably benign
acadia UTSW 4 41035510 missense probably benign 0.00
IGL03055:Aqp7 UTSW 4 41045326 missense probably benign 0.00
R0884:Aqp7 UTSW 4 41034929 missense possibly damaging 0.86
R1617:Aqp7 UTSW 4 41036109 missense probably null 0.74
R3551:Aqp7 UTSW 4 41045329 missense probably benign 0.04
R5340:Aqp7 UTSW 4 41034347 missense probably benign
R5689:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5690:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5691:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5692:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5710:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5711:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5713:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5751:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5817:Aqp7 UTSW 4 41035510 missense probably benign 0.00
R5820:Aqp7 UTSW 4 41035510 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACTCTCTTAGCTGTGCCAGG -3'
(R):5'- TCCCTGACTCTGATCTGAGAG -3'

Sequencing Primer
(F):5'- CTCTTAGCTGTGCCAGGGAAGG -3'
(R):5'- ACTCTGATCTGAGAGGCGTC -3'
Posted On2017-02-28