Incidental Mutation 'R5921:Ipo13'
ID461564
Institutional Source Beutler Lab
Gene Symbol Ipo13
Ensembl Gene ENSMUSG00000033365
Gene Nameimportin 13
SynonymsKap13
MMRRC Submission 044118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5921 (G1)
Quality Score220
Status Validated
Chromosome4
Chromosomal Location117894486-117914999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 117912089 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 169 (L169V)
Ref Sequence ENSEMBL: ENSMUSP00000035989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036156]
Predicted Effect probably benign
Transcript: ENSMUST00000036156
AA Change: L169V

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035989
Gene: ENSMUSG00000033365
AA Change: L169V

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
IBN_N 45 111 2.05e-7 SMART
Pfam:Xpo1 116 263 4.8e-29 PFAM
low complexity region 668 692 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.7%
Validation Efficiency 95% (70/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the importin-beta family of nuclear transport proteins. The encoded protein mediates the import of specific cargo proteins from the cytoplasm to the nucleus and is dependent on the Ras-related nuclear protein-GTPase system. The encoded protein is also involved in nuclear export of the eukaryotic translation initiation factor 1A.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion die prior to genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik G T 8: 13,734,840 A34S probably damaging Het
Ablim2 G A 5: 35,812,211 V223M probably damaging Het
Adamts7 T C 9: 90,188,694 S623P probably benign Het
Aqp7 G T 4: 41,036,093 N48K probably benign Het
Asic4 A G 1: 75,451,373 N181S probably benign Het
Blvra A T 2: 127,087,363 probably benign Het
Bmf C A 2: 118,532,553 probably benign Het
Bnc2 A T 4: 84,293,055 I454N possibly damaging Het
Catsperg1 A T 7: 29,190,523 L700H possibly damaging Het
Ccdc14 T C 16: 34,706,391 V222A probably damaging Het
Clstn3 A T 6: 124,431,580 probably benign Het
Col15a1 A T 4: 47,300,602 I1066F probably damaging Het
Dcdc2c T C 12: 28,524,775 E116G possibly damaging Het
Dopey1 G A 9: 86,501,922 S310N probably damaging Het
Dync1h1 T A 12: 110,618,368 V735E probably damaging Het
Eva1a T C 6: 82,092,159 Y156H probably damaging Het
Fbxw26 A G 9: 109,746,018 I13T probably damaging Het
Fermt2 A T 14: 45,464,746 L527Q probably damaging Het
Fxyd4 G A 6: 117,936,138 probably benign Het
Gal A G 19: 3,410,100 S124P probably damaging Het
Glmp T C 3: 88,325,976 S56P probably benign Het
Gm5600 T C 7: 113,708,176 noncoding transcript Het
Golga2 A G 2: 32,297,755 N194S probably benign Het
Gon4l T C 3: 88,909,947 probably benign Het
Gtf2ird2 T A 5: 134,217,584 Y895N probably damaging Het
Hsd3b1 C A 3: 98,857,899 M22I probably benign Het
Kif13a G T 13: 46,825,300 T208K probably damaging Het
Klhl5 G T 5: 65,162,956 A618S probably damaging Het
Lrig2 A T 3: 104,462,754 L496* probably null Het
Macf1 A G 4: 123,526,711 I250T probably benign Het
Man1a A G 10: 53,907,510 I632T probably damaging Het
Nav2 A G 7: 49,304,576 probably benign Het
Nek8 A G 11: 78,173,059 M40T probably damaging Het
Oas3 T C 5: 120,769,981 D298G probably damaging Het
Ociad1 A G 5: 73,310,382 D167G probably benign Het
Olfr115 A T 17: 37,610,219 C177* probably null Het
Olfr12 T A 1: 92,620,622 S239T probably benign Het
Olfr284 T C 15: 98,340,429 T187A probably benign Het
Pafah2 G T 4: 134,418,069 V255L probably benign Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Pirb A C 7: 3,716,694 Y484* probably null Het
Prl8a6 A G 13: 27,437,188 S20P probably damaging Het
R3hdm4 A T 10: 79,913,619 V52E probably damaging Het
Rab3ip A G 10: 116,939,247 Y69H probably damaging Het
Rxrg T C 1: 167,639,239 M330T possibly damaging Het
Sema4g G T 19: 44,998,704 G460V probably benign Het
Sidt1 T C 16: 44,273,735 probably benign Het
Slc12a2 T A 18: 57,932,523 D943E probably benign Het
Slc12a4 T C 8: 105,945,244 probably null Het
Slc4a3 T G 1: 75,557,444 probably null Het
Slc4a8 C T 15: 100,814,447 probably benign Het
Srcap T A 7: 127,558,833 probably benign Het
Stk39 A G 2: 68,366,105 S327P probably damaging Het
Tbc1d5 G A 17: 50,963,693 T170M probably damaging Het
Trim13 T A 14: 61,605,089 F185Y probably benign Het
Ttc17 A G 2: 94,378,848 V87A probably damaging Het
Ttn A T 2: 76,720,863 M31395K possibly damaging Het
Usp34 T A 11: 23,464,686 D2876E probably damaging Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn2r93 T A 17: 18,325,768 L634Q probably damaging Het
Vmp1 C T 11: 86,586,510 A355T probably benign Het
Xpo5 A T 17: 46,221,421 M461L probably benign Het
Zfp759 T A 13: 67,140,494 F703Y probably damaging Het
Other mutations in Ipo13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ipo13 APN 4 117903405 missense probably benign 0.10
IGL00800:Ipo13 APN 4 117912308 missense probably benign 0.31
IGL00971:Ipo13 APN 4 117914367 missense possibly damaging 0.83
IGL01552:Ipo13 APN 4 117900964 missense probably benign 0.16
IGL01957:Ipo13 APN 4 117903881 missense probably damaging 0.99
IGL02262:Ipo13 APN 4 117903813 missense probably damaging 1.00
R0109:Ipo13 UTSW 4 117905016 missense possibly damaging 0.92
R0142:Ipo13 UTSW 4 117905569 missense probably damaging 1.00
R0771:Ipo13 UTSW 4 117894646 missense possibly damaging 0.78
R1248:Ipo13 UTSW 4 117901031 missense probably damaging 1.00
R1381:Ipo13 UTSW 4 117904395 missense probably damaging 1.00
R1497:Ipo13 UTSW 4 117904659 missense probably benign 0.04
R1614:Ipo13 UTSW 4 117904618 missense probably benign 0.00
R1711:Ipo13 UTSW 4 117904522 missense probably benign 0.38
R2037:Ipo13 UTSW 4 117904661 nonsense probably null
R2200:Ipo13 UTSW 4 117904903 critical splice donor site probably null
R3698:Ipo13 UTSW 4 117900693 missense probably damaging 1.00
R3949:Ipo13 UTSW 4 117901042 missense probably benign 0.10
R4687:Ipo13 UTSW 4 117901576 missense probably benign 0.06
R4894:Ipo13 UTSW 4 117903441 missense probably damaging 0.99
R4894:Ipo13 UTSW 4 117904490 missense possibly damaging 0.84
R4956:Ipo13 UTSW 4 117901571 missense probably benign 0.00
R5679:Ipo13 UTSW 4 117894832 missense probably damaging 1.00
R5879:Ipo13 UTSW 4 117903203 missense possibly damaging 0.67
R6250:Ipo13 UTSW 4 117912154 missense possibly damaging 0.93
R6875:Ipo13 UTSW 4 117904911 missense possibly damaging 0.90
R7178:Ipo13 UTSW 4 117903884 missense possibly damaging 0.83
R7412:Ipo13 UTSW 4 117894871 missense probably benign
R7687:Ipo13 UTSW 4 117911891 missense probably benign 0.01
R7774:Ipo13 UTSW 4 117914297 missense probably benign 0.11
Z1088:Ipo13 UTSW 4 117904680 missense probably benign 0.14
Z1176:Ipo13 UTSW 4 117904630 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAACTGGAGAAGCACTTG -3'
(R):5'- CCGACCAGTATGAAAGCTTAAAGG -3'

Sequencing Primer
(F):5'- GAGAAGCACTTGAGCACCTTCTG -3'
(R):5'- GCTTAAAGGCACAGCTCTTC -3'
Posted On2017-02-28