Incidental Mutation 'R0565:Psmd2'
ID46157
Institutional Source Beutler Lab
Gene Symbol Psmd2
Ensembl Gene ENSMUSG00000006998
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 2
SynonymsTEG-190, Tex190, 9430095H01Rik
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0565 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20651652-20663414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20660426 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 678 (L678F)
Ref Sequence ENSEMBL: ENSMUSP00000007212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007212] [ENSMUST00000172207]
Predicted Effect probably null
Transcript: ENSMUST00000007212
AA Change: L678F

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007212
Gene: ENSMUSG00000006998
AA Change: L678F

DomainStartEndE-ValueType
Pfam:PC_rep 443 479 3.7e-9 PFAM
Pfam:PC_rep 480 514 1.3e-8 PFAM
low complexity region 571 581 N/A INTRINSIC
SCOP:d1gw5b_ 617 773 1e-8 SMART
PDB:4CR4|Z 653 906 3e-57 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169184
Predicted Effect probably benign
Transcript: ENSMUST00000172207
Predicted Effect probably benign
Transcript: ENSMUST00000231897
Predicted Effect probably benign
Transcript: ENSMUST00000232513
Meta Mutation Damage Score 0.1843 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Psmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Psmd2 APN 16 20659405 splice site probably null
IGL02348:Psmd2 APN 16 20654647 missense probably benign 0.07
IGL02352:Psmd2 APN 16 20656941 missense probably benign 0.13
IGL02359:Psmd2 APN 16 20656941 missense probably benign 0.13
R0012:Psmd2 UTSW 16 20661684 missense probably damaging 0.99
R0144:Psmd2 UTSW 16 20662225 splice site probably null
R0739:Psmd2 UTSW 16 20655329 missense probably benign 0.01
R1075:Psmd2 UTSW 16 20659959 missense probably damaging 0.98
R1189:Psmd2 UTSW 16 20661894 missense probably benign 0.17
R1231:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1405:Psmd2 UTSW 16 20652284 missense possibly damaging 0.83
R1466:Psmd2 UTSW 16 20657965 unclassified probably benign
R1556:Psmd2 UTSW 16 20655585 missense possibly damaging 0.83
R1843:Psmd2 UTSW 16 20656582 missense probably benign 0.02
R2398:Psmd2 UTSW 16 20659472 missense possibly damaging 0.86
R2421:Psmd2 UTSW 16 20660106 splice site probably null
R2520:Psmd2 UTSW 16 20663076 missense probably damaging 1.00
R3040:Psmd2 UTSW 16 20657567 missense probably benign 0.08
R3905:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3906:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R3909:Psmd2 UTSW 16 20655642 missense probably benign 0.07
R4027:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4029:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4031:Psmd2 UTSW 16 20663205 missense probably damaging 0.98
R4357:Psmd2 UTSW 16 20656652 missense probably benign
R4410:Psmd2 UTSW 16 20655026 missense probably damaging 0.96
R4678:Psmd2 UTSW 16 20659969 missense probably damaging 1.00
R4737:Psmd2 UTSW 16 20659815 unclassified probably benign
R4771:Psmd2 UTSW 16 20662679 missense probably damaging 0.99
R5081:Psmd2 UTSW 16 20661655 missense probably benign 0.14
R5124:Psmd2 UTSW 16 20652698 missense possibly damaging 0.93
R5801:Psmd2 UTSW 16 20654922 missense probably damaging 0.96
R6381:Psmd2 UTSW 16 20655273 missense probably benign 0.03
R6732:Psmd2 UTSW 16 20662636 missense probably benign 0.02
R6870:Psmd2 UTSW 16 20661843 missense probably benign 0.33
R7030:Psmd2 UTSW 16 20662133 missense probably damaging 1.00
R7137:Psmd2 UTSW 16 20652627 missense probably benign 0.12
R7432:Psmd2 UTSW 16 20654925 missense probably damaging 0.99
R8673:Psmd2 UTSW 16 20656888 missense probably damaging 1.00
R8685:Psmd2 UTSW 16 20655411 missense probably benign
Z1176:Psmd2 UTSW 16 20662660 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGTTCAGCAGCTCCTCCACATC -3'
(R):5'- GCATTTACACACAAGCACGTATGGC -3'

Sequencing Primer
(F):5'- ggaaaaggaggaagacaaagac -3'
(R):5'- CAAGCACGTATGGCAAATAATAGC -3'
Posted On2013-06-11