Mutagenetix > Incidental Mutations

Incidental Mutation 'R5922:Brinp2'

461615

Institutional Source

Beutler Lab

Gene Symbol

Brinp2

Ensembl Gene

ENSMUSG00000004031

Gene Name

bone morphogenic protein/retinoic acid inducible neural-specific 2

Synonyms

6430517E21Rik, Fam5b

MMRRC Submission

043240-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R5922 (G1)

Quality Score

208

Status

Not validated

Chromosome

Chromosomal Location

158245269-158356326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 158249355 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 390 (V390D)

Ref Sequence

ENSEMBL: ENSMUSP00000004133 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004133] [ENSMUST00000195271]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000004133
AA Change: V390D

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000004133
Gene: ENSMUSG00000004031
AA Change: V390D

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
MACPF	89	281	6.58e-50	SMART
Blast:MACPF	338	362	1e-5	BLAST
EGF	457	492	6.92e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000195271

SMART Domains

Protein: ENSMUSP00000141709
Gene: ENSMUSG00000004031

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:MACPF	63	160	2.1e-6	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7a	G	T	4: 56,743,827	R118L	probably damaging	Het
Atr	A	G	9: 95,903,682	D1429G	probably benign	Het
Cpn1	T	C	19: 43,986,093	S66G	probably damaging	Het
Dnal1	C	A	12: 84,126,972	L55M	probably damaging	Het
Dus2	G	A	8: 106,053,405	R453Q	possibly damaging	Het
Efcab5	T	C	11: 77,188,744	T59A	probably benign	Het
Elmo1	A	G	13: 20,605,169	D685G	probably damaging	Het
Ern1	T	C	11: 106,421,730	E275G	probably damaging	Het
Etnk2	A	G	1: 133,363,885		probably null	Het
Fign	T	C	2: 63,979,060	D622G	probably damaging	Het
Gjb2	A	G	14: 57,100,298	M151T	probably benign	Het
Heatr9	C	T	11: 83,512,367		probably null	Het
Herpud2	G	A	9: 25,108,984	L359F	probably benign	Het
Hpx	C	T	7: 105,595,624	R118H	probably damaging	Het
Hyal2	A	G	9: 107,570,907	Y253C	probably damaging	Het
Igkv14-130	T	C	6: 67,791,222	C22R	probably damaging	Het
Ms4a6b	T	A	19: 11,520,379	I14N	possibly damaging	Het
Myb	T	A	10: 21,152,927	I91F	probably damaging	Het
Myh6	C	T	14: 54,946,474	D1668N	probably damaging	Het
Noc2l	C	T	4: 156,241,313	Q182*	probably null	Het
Nsd1	A	G	13: 55,247,475	N1066S	probably benign	Het
Nup98	A	G	7: 102,154,017	Y659H	probably damaging	Het
Nutm1	T	C	2: 112,249,314	E752G	possibly damaging	Het
Paqr6	G	T	3: 88,366,237	A154S	probably benign	Het
Pdlim7	G	T	13: 55,508,955	T62K	probably damaging	Het
Pibf1	A	G	14: 99,137,088	D321G	probably benign	Het
Plrg1	T	A	3: 83,056,848	N29K	possibly damaging	Het
Scimp	A	C	11: 70,800,816		probably null	Het
Sec16a	T	C	2: 26,415,639	N2251S	probably benign	Het
Sec61a2	A	T	2: 5,874,323	D291E	possibly damaging	Het
Serpina3i	A	G	12: 104,266,507	K224E	probably benign	Het
Spz1	A	T	13: 92,575,598	D123E	possibly damaging	Het
St14	A	T	9: 31,129,904		probably benign	Het
Ush1c	A	T	7: 46,204,128		probably null	Het
Usp54	T	C	14: 20,552,071		probably null	Het
Zfhx3	C	T	8: 108,946,698	T1460M	probably damaging	Het
Zfp712	G	T	13: 67,041,604	N286K	probably benign	Het

Other mutations in Brinp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Brinp2	APN	1	158247100	missense	probably benign	0.04
IGL01537:Brinp2	APN	1	158246809	missense	probably damaging	1.00
IGL02354:Brinp2	APN	1	158247178	missense	probably damaging	1.00
IGL02361:Brinp2	APN	1	158247178	missense	probably damaging	1.00
R0334:Brinp2	UTSW	1	158295585	missense	probably benign	0.06
R0652:Brinp2	UTSW	1	158246621	missense	probably damaging	1.00
R1017:Brinp2	UTSW	1	158249451	missense	probably damaging	0.99
R1141:Brinp2	UTSW	1	158247270	missense	probably damaging	0.99
R1378:Brinp2	UTSW	1	158247054	missense	possibly damaging	0.82
R1666:Brinp2	UTSW	1	158246558	missense	probably damaging	1.00
R1892:Brinp2	UTSW	1	158254972	critical splice donor site	probably null
R1986:Brinp2	UTSW	1	158246778	missense	probably damaging	1.00
R3876:Brinp2	UTSW	1	158246846	missense	probably damaging	0.99
R3924:Brinp2	UTSW	1	158246208	missense	probably damaging	1.00
R4582:Brinp2	UTSW	1	158267938	missense	probably damaging	1.00
R5239:Brinp2	UTSW	1	158251338	missense	probably benign	0.00
R5537:Brinp2	UTSW	1	158255013	missense	probably damaging	0.97
R5582:Brinp2	UTSW	1	158249409	missense	probably damaging	1.00
R5762:Brinp2	UTSW	1	158246586	missense	probably benign
R6746:Brinp2	UTSW	1	158266590	missense	probably benign
R6999:Brinp2	UTSW	1	158251305	missense	probably benign	0.20
R7144:Brinp2	UTSW	1	158295424	critical splice donor site	probably null
R7221:Brinp2	UTSW	1	158266547	missense	possibly damaging	0.90
R7376:Brinp2	UTSW	1	158251368	missense	probably damaging	0.98
R7381:Brinp2	UTSW	1	158246343	missense	probably benign	0.11
R7388:Brinp2	UTSW	1	158255009	missense	probably damaging	1.00
R7531:Brinp2	UTSW	1	158266572	missense	possibly damaging	0.95
R7697:Brinp2	UTSW	1	158267926	missense	probably benign
R7701:Brinp2	UTSW	1	158266460	critical splice donor site	probably null
R7910:Brinp2	UTSW	1	158246880	missense	probably damaging	1.00
R7991:Brinp2	UTSW	1	158246880	missense	probably damaging	1.00
X0024:Brinp2	UTSW	1	158267983	nonsense	probably null
Z1088:Brinp2	UTSW	1	158246989	nonsense	probably null
Z1176:Brinp2	UTSW	1	158247039	missense	probably damaging	1.00
Z1176:Brinp2	UTSW	1	158247171	nonsense	probably null
Z1177:Brinp2	UTSW	1	158246782	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GAGTCTGCAGGTCCAGAATGAC -3'
(R):5'- GACTACATAGCTTCGCTCTGC -3'

Sequencing Primer
(F):5'- AGAATGACTGAATGGGTCACC -3'
(R):5'- ACATAGCTTCGCTCTGCTCAGAC -3'

Posted On

2017-02-28