Incidental Mutation 'R5922:Plrg1'
ID461620
Institutional Source Beutler Lab
Gene Symbol Plrg1
Ensembl Gene ENSMUSG00000027998
Gene Namepleiotropic regulator 1
SynonymsTango4
MMRRC Submission 043240-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5922 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location83055522-83072355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83056848 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 29 (N29K)
Ref Sequence ENSEMBL: ENSMUSP00000029628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029628] [ENSMUST00000122128] [ENSMUST00000150268]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029628
AA Change: N29K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029628
Gene: ENSMUSG00000027998
AA Change: N29K

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122128
AA Change: N29K

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113614
Gene: ENSMUSG00000027998
AA Change: N29K

DomainStartEndE-ValueType
WD40 183 222 1.92e-10 SMART
WD40 225 264 1.68e-6 SMART
WD40 267 306 1.96e-7 SMART
WD40 309 348 5.95e-7 SMART
WD40 351 389 1.12e-2 SMART
WD40 392 430 5.47e-6 SMART
WD40 442 480 5.97e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150268
AA Change: N29K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000114968
Gene: ENSMUSG00000027998
AA Change: N29K

DomainStartEndE-ValueType
WD40 192 231 1.92e-10 SMART
WD40 234 273 1.68e-6 SMART
WD40 276 315 1.96e-7 SMART
WD40 318 357 5.95e-7 SMART
WD40 360 398 1.12e-2 SMART
WD40 401 439 5.47e-6 SMART
WD40 451 489 5.97e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the cell division cycle 5-like (CDC5L) complex. The CDC5L complex is part of the spliceosome and is required for pre-mRNA splicing. The encoded protein plays a critical role in alternative splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality by E1.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atr A G 9: 95,903,682 D1429G probably benign Het
Brinp2 A T 1: 158,249,355 V390D possibly damaging Het
Cpn1 T C 19: 43,986,093 S66G probably damaging Het
Dnal1 C A 12: 84,126,972 L55M probably damaging Het
Dus2 G A 8: 106,053,405 R453Q possibly damaging Het
Efcab5 T C 11: 77,188,744 T59A probably benign Het
Elmo1 A G 13: 20,605,169 D685G probably damaging Het
Ern1 T C 11: 106,421,730 E275G probably damaging Het
Etnk2 A G 1: 133,363,885 probably null Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Gjb2 A G 14: 57,100,298 M151T probably benign Het
Heatr9 C T 11: 83,512,367 probably null Het
Herpud2 G A 9: 25,108,984 L359F probably benign Het
Hpx C T 7: 105,595,624 R118H probably damaging Het
Hyal2 A G 9: 107,570,907 Y253C probably damaging Het
Igkv14-130 T C 6: 67,791,222 C22R probably damaging Het
Ms4a6b T A 19: 11,520,379 I14N possibly damaging Het
Myb T A 10: 21,152,927 I91F probably damaging Het
Myh6 C T 14: 54,946,474 D1668N probably damaging Het
Noc2l C T 4: 156,241,313 Q182* probably null Het
Nsd1 A G 13: 55,247,475 N1066S probably benign Het
Nup98 A G 7: 102,154,017 Y659H probably damaging Het
Nutm1 T C 2: 112,249,314 E752G possibly damaging Het
Paqr6 G T 3: 88,366,237 A154S probably benign Het
Pdlim7 G T 13: 55,508,955 T62K probably damaging Het
Pibf1 A G 14: 99,137,088 D321G probably benign Het
Scimp A C 11: 70,800,816 probably null Het
Sec16a T C 2: 26,415,639 N2251S probably benign Het
Sec61a2 A T 2: 5,874,323 D291E possibly damaging Het
Serpina3i A G 12: 104,266,507 K224E probably benign Het
Spz1 A T 13: 92,575,598 D123E possibly damaging Het
St14 A T 9: 31,129,904 probably benign Het
Ush1c A T 7: 46,204,128 probably null Het
Usp54 T C 14: 20,552,071 probably null Het
Zfhx3 C T 8: 108,946,698 T1460M probably damaging Het
Zfp712 G T 13: 67,041,604 N286K probably benign Het
Other mutations in Plrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Plrg1 APN 3 83070673 missense probably damaging 0.99
IGL00824:Plrg1 APN 3 83068335 missense probably damaging 1.00
IGL00948:Plrg1 APN 3 83068119 missense probably damaging 1.00
IGL02550:Plrg1 APN 3 83061123 critical splice donor site probably null
R0743:Plrg1 UTSW 3 83059917 missense probably benign 0.11
R1624:Plrg1 UTSW 3 83067994 splice site probably benign
R1624:Plrg1 UTSW 3 83069744 missense probably damaging 1.00
R1630:Plrg1 UTSW 3 83058763 missense probably benign 0.00
R1876:Plrg1 UTSW 3 83069068 splice site probably benign
R2383:Plrg1 UTSW 3 83065948 missense probably damaging 1.00
R2892:Plrg1 UTSW 3 83071240 missense probably damaging 1.00
R3406:Plrg1 UTSW 3 83071219 missense probably damaging 1.00
R5114:Plrg1 UTSW 3 83071251 missense probably benign 0.13
R6333:Plrg1 UTSW 3 83056795 missense probably damaging 1.00
R7127:Plrg1 UTSW 3 83059915 missense probably damaging 1.00
R7530:Plrg1 UTSW 3 83058682 missense probably damaging 1.00
R7814:Plrg1 UTSW 3 83056837 missense probably damaging 1.00
R8123:Plrg1 UTSW 3 83065930 missense probably benign 0.16
R8131:Plrg1 UTSW 3 83069774 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCATATTTAGCGTGGAAATTGC -3'
(R):5'- CTGGGTGCCTGTAAACTATAGTTAG -3'

Sequencing Primer
(F):5'- GCGTGGAAATTGCATAATGACTCTC -3'
(R):5'- GATGTTTTTACTGCAGAAGACAAGAC -3'
Posted On2017-02-28