Incidental Mutation 'R5922:Paqr6'
ID461621
Institutional Source Beutler Lab
Gene Symbol Paqr6
Ensembl Gene ENSMUSG00000041423
Gene Nameprogestin and adipoQ receptor family member VI
Synonyms
MMRRC Submission 043240-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5922 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88364584-88368541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88366237 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 154 (A154S)
Ref Sequence ENSEMBL: ENSMUSP00000114166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451] [ENSMUST00000075523] [ENSMUST00000107542] [ENSMUST00000107543] [ENSMUST00000147948] [ENSMUST00000147991]
Predicted Effect probably benign
Transcript: ENSMUST00000001451
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075523
SMART Domains Protein: ENSMUSP00000074965
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107542
SMART Domains Protein: ENSMUSP00000103166
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107543
SMART Domains Protein: ENSMUSP00000103167
Gene: ENSMUSG00000074489

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
GLA 31 91 5.9e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147818
Predicted Effect probably benign
Transcript: ENSMUST00000147948
SMART Domains Protein: ENSMUSP00000119656
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 59 161 6.8e-18 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147991
AA Change: A154S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114166
Gene: ENSMUSG00000041423
AA Change: A154S

DomainStartEndE-ValueType
Pfam:HlyIII 43 271 5.5e-51 PFAM
transmembrane domain 292 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193224
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atr A G 9: 95,903,682 D1429G probably benign Het
Brinp2 A T 1: 158,249,355 V390D possibly damaging Het
Cpn1 T C 19: 43,986,093 S66G probably damaging Het
Dnal1 C A 12: 84,126,972 L55M probably damaging Het
Dus2 G A 8: 106,053,405 R453Q possibly damaging Het
Efcab5 T C 11: 77,188,744 T59A probably benign Het
Elmo1 A G 13: 20,605,169 D685G probably damaging Het
Ern1 T C 11: 106,421,730 E275G probably damaging Het
Etnk2 A G 1: 133,363,885 probably null Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Gjb2 A G 14: 57,100,298 M151T probably benign Het
Heatr9 C T 11: 83,512,367 probably null Het
Herpud2 G A 9: 25,108,984 L359F probably benign Het
Hpx C T 7: 105,595,624 R118H probably damaging Het
Hyal2 A G 9: 107,570,907 Y253C probably damaging Het
Igkv14-130 T C 6: 67,791,222 C22R probably damaging Het
Ms4a6b T A 19: 11,520,379 I14N possibly damaging Het
Myb T A 10: 21,152,927 I91F probably damaging Het
Myh6 C T 14: 54,946,474 D1668N probably damaging Het
Noc2l C T 4: 156,241,313 Q182* probably null Het
Nsd1 A G 13: 55,247,475 N1066S probably benign Het
Nup98 A G 7: 102,154,017 Y659H probably damaging Het
Nutm1 T C 2: 112,249,314 E752G possibly damaging Het
Pdlim7 G T 13: 55,508,955 T62K probably damaging Het
Pibf1 A G 14: 99,137,088 D321G probably benign Het
Plrg1 T A 3: 83,056,848 N29K possibly damaging Het
Scimp A C 11: 70,800,816 probably null Het
Sec16a T C 2: 26,415,639 N2251S probably benign Het
Sec61a2 A T 2: 5,874,323 D291E possibly damaging Het
Serpina3i A G 12: 104,266,507 K224E probably benign Het
Spz1 A T 13: 92,575,598 D123E possibly damaging Het
St14 A T 9: 31,129,904 probably benign Het
Ush1c A T 7: 46,204,128 probably null Het
Usp54 T C 14: 20,552,071 probably null Het
Zfhx3 C T 8: 108,946,698 T1460M probably damaging Het
Zfp712 G T 13: 67,041,604 N286K probably benign Het
Other mutations in Paqr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Paqr6 APN 3 88366184 missense probably damaging 1.00
IGL02622:Paqr6 APN 3 88365778 missense probably damaging 1.00
PIT4431001:Paqr6 UTSW 3 88365777 missense possibly damaging 0.87
R0883:Paqr6 UTSW 3 88365991 missense probably damaging 1.00
R2369:Paqr6 UTSW 3 88365953 missense probably damaging 1.00
R4705:Paqr6 UTSW 3 88365929 missense probably benign 0.03
R5103:Paqr6 UTSW 3 88367717 nonsense probably null
R6292:Paqr6 UTSW 3 88367898 missense probably damaging 1.00
R6364:Paqr6 UTSW 3 88365958 missense probably damaging 0.98
R7023:Paqr6 UTSW 3 88366046 missense probably damaging 1.00
Z1177:Paqr6 UTSW 3 88365709 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTTTAGCTCCATGTCG -3'
(R):5'- AAGGATAGCATACTGGCCAAC -3'

Sequencing Primer
(F):5'- TACTTCCTGGACTACGGGG -3'
(R):5'- TGGCCAACAGGAATGCCTC -3'
Posted On2017-02-28