Incidental Mutation 'R0565:Efna5'
ID46163
Institutional Source Beutler Lab
Gene Symbol Efna5
Ensembl Gene ENSMUSG00000048915
Gene Nameephrin A5
SynonymsEFL-5, Epl7, RAGS, AL-1, LERK-7, Ephrin-A5
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0565 (G1)
Quality Score143
Status Validated
Chromosome17
Chromosomal Location62604184-62881317 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62881036 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 32 (Y32C)
Ref Sequence ENSEMBL: ENSMUSP00000077883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076840] [ENSMUST00000078839]
Predicted Effect probably damaging
Transcript: ENSMUST00000076840
AA Change: Y32C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076115
Gene: ENSMUSG00000048915
AA Change: Y32C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 29 158 4.5e-42 PFAM
low complexity region 214 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078839
AA Change: Y32C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077883
Gene: ENSMUSG00000048915
AA Change: Y32C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 26 164 2.4e-58 PFAM
low complexity region 187 201 N/A INTRINSIC
Meta Mutation Damage Score 0.5102 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin-A5, a member of the ephrin gene family, prevents axon bundling in cocultures of cortical neurons with astrocytes, a model of late stage nervous system development and differentiation. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormalities in establishing correct axonal connections involving the retinal, motor, vomeronasal, and tactile axons to their respective targets. Some mutants develop neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Efna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Efna5 APN 17 62613379 missense possibly damaging 0.73
IGL02142:Efna5 APN 17 62607345 missense unknown
IGL02152:Efna5 APN 17 62651060 missense probably benign
IGL02534:Efna5 APN 17 62613389 nonsense probably null
IGL02556:Efna5 APN 17 62651028 missense probably damaging 0.99
R0041:Efna5 UTSW 17 62607472 splice site probably benign
R0265:Efna5 UTSW 17 62651073 missense probably damaging 1.00
R0422:Efna5 UTSW 17 62607419 missense probably benign 0.05
R2039:Efna5 UTSW 17 62881066 missense probably benign 0.00
R2570:Efna5 UTSW 17 62881028 missense probably benign 0.04
R4621:Efna5 UTSW 17 62651045 missense probably benign 0.00
R4622:Efna5 UTSW 17 62651045 missense probably benign 0.00
R5672:Efna5 UTSW 17 62881030 missense probably damaging 1.00
R5723:Efna5 UTSW 17 62607463 missense probably damaging 1.00
R7876:Efna5 UTSW 17 62650934 missense possibly damaging 0.74
R7959:Efna5 UTSW 17 62650934 missense possibly damaging 0.74
R8049:Efna5 UTSW 17 62650982 missense probably benign 0.39
RF007:Efna5 UTSW 17 62613394 missense probably benign 0.00
X0021:Efna5 UTSW 17 62607400 missense probably damaging 0.98
X0025:Efna5 UTSW 17 62651037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGCTTAACAAAGAGCGGCG -3'
(R):5'- GCTCAACTCCCCGTGACTGTGC -3'

Sequencing Primer
(F):5'- GTCTGGCGACGCAGGCT -3'
(R):5'- cctccttcttctctctctcctc -3'
Posted On2013-06-11