Incidental Mutation 'R0565:Vit'
ID46164
Institutional Source Beutler Lab
Gene Symbol Vit
Ensembl Gene ENSMUSG00000024076
Gene Namevitrin
Synonyms
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0565 (G1)
Quality Score206
Status Validated
Chromosome17
Chromosomal Location78508063-78627409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78624837 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 458 (C458S)
Ref Sequence ENSEMBL: ENSMUSP00000024880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024880]
Predicted Effect probably damaging
Transcript: ENSMUST00000024880
AA Change: C458S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024880
Gene: ENSMUSG00000024076
AA Change: C458S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LCCL 42 124 2.5e-45 SMART
low complexity region 148 171 N/A INTRINSIC
VWA 263 451 7.34e-39 SMART
VWA 465 641 1.02e-46 SMART
Meta Mutation Damage Score 0.4178 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix (ECM) protein. The protein may be associated with cell adhesion and migration. High levels of expression of the protein in specific parts of the brain suggest its likely role in neural development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Embryos homozygous for a knock-out allele show decreased spinal cord size associated with reduced cell proliferation and altered cell differentiation in the central canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Vit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vit APN 17 78601907 critical splice donor site probably null
IGL00929:Vit APN 17 78579401 missense probably damaging 0.98
IGL01447:Vit APN 17 78625204 missense probably damaging 1.00
IGL02000:Vit APN 17 78605486 missense possibly damaging 0.94
IGL02230:Vit APN 17 78619627 missense probably damaging 1.00
IGL02245:Vit APN 17 78625051 missense probably damaging 1.00
IGL02315:Vit APN 17 78622658 missense possibly damaging 0.80
IGL03133:Vit APN 17 78566071 missense probably benign
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0025:Vit UTSW 17 78599835 missense probably benign 0.00
R0520:Vit UTSW 17 78625159 missense probably damaging 1.00
R0550:Vit UTSW 17 78624793 missense possibly damaging 0.95
R0856:Vit UTSW 17 78619657 missense possibly damaging 0.53
R1155:Vit UTSW 17 78566027 missense probably damaging 1.00
R1327:Vit UTSW 17 78625200 missense probably damaging 1.00
R1690:Vit UTSW 17 78624865 missense probably damaging 1.00
R1802:Vit UTSW 17 78605511 missense possibly damaging 0.91
R1822:Vit UTSW 17 78622836 missense probably benign 0.01
R1826:Vit UTSW 17 78534676 missense probably benign 0.22
R1827:Vit UTSW 17 78546446 critical splice donor site probably null
R1862:Vit UTSW 17 78622746 missense probably damaging 1.00
R2235:Vit UTSW 17 78605438 missense probably benign 0.01
R2571:Vit UTSW 17 78586745 missense probably benign
R4011:Vit UTSW 17 78534692 splice site probably benign
R4190:Vit UTSW 17 78586826 missense probably benign 0.13
R4191:Vit UTSW 17 78586826 missense probably benign 0.13
R4192:Vit UTSW 17 78586826 missense probably benign 0.13
R4193:Vit UTSW 17 78586826 missense probably benign 0.13
R4635:Vit UTSW 17 78574212 missense probably benign 0.01
R4705:Vit UTSW 17 78625114 missense probably damaging 1.00
R4841:Vit UTSW 17 78601879 missense probably benign
R4842:Vit UTSW 17 78601879 missense probably benign
R4884:Vit UTSW 17 78624753 missense probably damaging 0.99
R4923:Vit UTSW 17 78586841 missense probably benign 0.03
R5128:Vit UTSW 17 78625146 missense probably damaging 1.00
R5272:Vit UTSW 17 78586835 missense probably benign
R5779:Vit UTSW 17 78546426 missense probably benign
R6596:Vit UTSW 17 78622845 missense probably benign 0.35
R6658:Vit UTSW 17 78622803 missense possibly damaging 0.93
R6792:Vit UTSW 17 78579399 missense probably damaging 1.00
R6894:Vit UTSW 17 78626758 nonsense probably null
R7032:Vit UTSW 17 78624865 missense probably damaging 1.00
R7061:Vit UTSW 17 78625156 missense probably damaging 1.00
R7102:Vit UTSW 17 78624997 missense probably damaging 1.00
R7106:Vit UTSW 17 78586799 missense probably benign
R7292:Vit UTSW 17 78605498 missense probably benign 0.03
R7413:Vit UTSW 17 78624880 missense probably damaging 1.00
X0023:Vit UTSW 17 78566164 missense probably benign
X0064:Vit UTSW 17 78624885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAATGAGTTGAGACGCCAATG -3'
(R):5'- ACTTGTCGAACCCAAATTCGAGCC -3'

Sequencing Primer
(F):5'- TTTTCCACTGAGACAGGGAC -3'
(R):5'- CAAATTCGAGCCGCTGC -3'
Posted On2013-06-11