Incidental Mutation 'R0565:Osbpl1a'
ID46165
Institutional Source Beutler Lab
Gene Symbol Osbpl1a
Ensembl Gene ENSMUSG00000044252
Gene Nameoxysterol binding protein-like 1A
SynonymsLOC328902, G430090F17Rik
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R0565 (G1)
Quality Score132
Status Validated
Chromosome18
Chromosomal Location12755314-12941841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12759444 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 438 (S438R)
Ref Sequence ENSEMBL: ENSMUSP00000113914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000119512] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000186263] [ENSMUST00000191078] [ENSMUST00000150758]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074352
AA Change: S830R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252
AA Change: S830R

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117361
AA Change: S317R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252
AA Change: S317R

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118313
AA Change: S317R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252
AA Change: S317R

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119043
AA Change: S317R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252
AA Change: S317R

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119512
AA Change: S438R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252
AA Change: S438R

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121018
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121774
AA Change: S290R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252
AA Change: S290R

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121808
AA Change: S317R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252
AA Change: S317R

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121888
AA Change: S317R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252
AA Change: S317R

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145777
Predicted Effect probably benign
Transcript: ENSMUST00000186263
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191078
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150758
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. Transcript variants derived from alternative promoter usage and/or alternative splicing exist; they encode different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Osbpl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Osbpl1a APN 18 12757626 missense possibly damaging 0.51
IGL01062:Osbpl1a APN 18 12905075 missense probably benign
IGL01450:Osbpl1a APN 18 12871095 missense possibly damaging 0.88
IGL01531:Osbpl1a APN 18 12933581 missense probably damaging 1.00
IGL01548:Osbpl1a APN 18 12763575 missense probably damaging 1.00
IGL01606:Osbpl1a APN 18 12756214 missense possibly damaging 0.79
IGL01672:Osbpl1a APN 18 12766824 missense probably damaging 1.00
IGL02372:Osbpl1a APN 18 12841313 nonsense probably null
IGL02451:Osbpl1a APN 18 12914493 splice site probably benign
IGL02490:Osbpl1a APN 18 12882284 unclassified probably benign
IGL02884:Osbpl1a APN 18 12819578 nonsense probably null
R0084:Osbpl1a UTSW 18 12757612 missense probably benign 0.07
R0266:Osbpl1a UTSW 18 12871163 splice site probably null
R0605:Osbpl1a UTSW 18 12882279 critical splice acceptor site probably null
R0899:Osbpl1a UTSW 18 12757690 missense possibly damaging 0.70
R1330:Osbpl1a UTSW 18 12882194 critical splice donor site probably null
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1464:Osbpl1a UTSW 18 12914558 missense probably benign
R1475:Osbpl1a UTSW 18 12757680 missense probably damaging 1.00
R1495:Osbpl1a UTSW 18 12758839 missense probably benign 0.08
R1734:Osbpl1a UTSW 18 12788316 splice site probably null
R1930:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R1931:Osbpl1a UTSW 18 12905194 missense probably benign 0.04
R2109:Osbpl1a UTSW 18 12759400 missense probably damaging 1.00
R2144:Osbpl1a UTSW 18 12871173 missense probably benign 0.06
R2504:Osbpl1a UTSW 18 12905031 missense probably benign 0.30
R2762:Osbpl1a UTSW 18 12766899 missense possibly damaging 0.83
R2907:Osbpl1a UTSW 18 12871072 unclassified probably benign
R4306:Osbpl1a UTSW 18 12819595 missense probably benign
R4835:Osbpl1a UTSW 18 12768536 critical splice donor site probably null
R5097:Osbpl1a UTSW 18 12763537 missense probably damaging 1.00
R5173:Osbpl1a UTSW 18 12762640 missense probably benign 0.12
R5224:Osbpl1a UTSW 18 12933696 missense probably benign 0.01
R5245:Osbpl1a UTSW 18 12758853 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12841192 missense probably damaging 1.00
R5579:Osbpl1a UTSW 18 12892262 missense probably benign 0.22
R5833:Osbpl1a UTSW 18 12788362 missense probably damaging 1.00
R5986:Osbpl1a UTSW 18 12905081 missense probably damaging 1.00
R6267:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6296:Osbpl1a UTSW 18 12819503 critical splice donor site probably null
R6477:Osbpl1a UTSW 18 12756261 missense probably benign 0.03
R6997:Osbpl1a UTSW 18 12756224 missense probably benign 0.05
R7105:Osbpl1a UTSW 18 12766963 missense probably benign 0.17
R7107:Osbpl1a UTSW 18 12841253 nonsense probably null
R7154:Osbpl1a UTSW 18 12768592 missense probably benign 0.00
R7459:Osbpl1a UTSW 18 12933585 missense probably damaging 1.00
R7757:Osbpl1a UTSW 18 12933600 missense probably benign 0.44
R7797:Osbpl1a UTSW 18 12882264 missense probably damaging 0.99
R8029:Osbpl1a UTSW 18 12914521 missense probably benign 0.01
R8084:Osbpl1a UTSW 18 12905042 missense probably damaging 1.00
R8506:Osbpl1a UTSW 18 12768586 missense probably benign 0.02
X0027:Osbpl1a UTSW 18 12759503 missense possibly damaging 0.46
Z1177:Osbpl1a UTSW 18 12906923 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGAGAGCAAGCCCTCTGCATAAG -3'
(R):5'- TGCCTACACAAGCCTCAGTCTGTC -3'

Sequencing Primer
(F):5'- CCTCTGCATAAGGAGGGAATG -3'
(R):5'- CTGGCCTTTGGGAAAACTGC -3'
Posted On2013-06-11