Incidental Mutation 'R5922:Usp54'
ID461651
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Nameubiquitin specific peptidase 54
SynonymsC030002J06Rik, 4930429G18Rik
MMRRC Submission 043240-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5922 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20548912-20641063 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 20552071 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022356] [ENSMUST00000035340]
Predicted Effect probably null
Transcript: ENSMUST00000022356
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000035340
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atr A G 9: 95,903,682 D1429G probably benign Het
Brinp2 A T 1: 158,249,355 V390D possibly damaging Het
Cpn1 T C 19: 43,986,093 S66G probably damaging Het
Dnal1 C A 12: 84,126,972 L55M probably damaging Het
Dus2 G A 8: 106,053,405 R453Q possibly damaging Het
Efcab5 T C 11: 77,188,744 T59A probably benign Het
Elmo1 A G 13: 20,605,169 D685G probably damaging Het
Ern1 T C 11: 106,421,730 E275G probably damaging Het
Etnk2 A G 1: 133,363,885 probably null Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Gjb2 A G 14: 57,100,298 M151T probably benign Het
Heatr9 C T 11: 83,512,367 probably null Het
Herpud2 G A 9: 25,108,984 L359F probably benign Het
Hpx C T 7: 105,595,624 R118H probably damaging Het
Hyal2 A G 9: 107,570,907 Y253C probably damaging Het
Igkv14-130 T C 6: 67,791,222 C22R probably damaging Het
Ms4a6b T A 19: 11,520,379 I14N possibly damaging Het
Myb T A 10: 21,152,927 I91F probably damaging Het
Myh6 C T 14: 54,946,474 D1668N probably damaging Het
Noc2l C T 4: 156,241,313 Q182* probably null Het
Nsd1 A G 13: 55,247,475 N1066S probably benign Het
Nup98 A G 7: 102,154,017 Y659H probably damaging Het
Nutm1 T C 2: 112,249,314 E752G possibly damaging Het
Paqr6 G T 3: 88,366,237 A154S probably benign Het
Pdlim7 G T 13: 55,508,955 T62K probably damaging Het
Pibf1 A G 14: 99,137,088 D321G probably benign Het
Plrg1 T A 3: 83,056,848 N29K possibly damaging Het
Scimp A C 11: 70,800,816 probably null Het
Sec16a T C 2: 26,415,639 N2251S probably benign Het
Sec61a2 A T 2: 5,874,323 D291E possibly damaging Het
Serpina3i A G 12: 104,266,507 K224E probably benign Het
Spz1 A T 13: 92,575,598 D123E possibly damaging Het
St14 A T 9: 31,129,904 probably benign Het
Ush1c A T 7: 46,204,128 probably null Het
Zfhx3 C T 8: 108,946,698 T1460M probably damaging Het
Zfp712 G T 13: 67,041,604 N286K probably benign Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20573837 missense probably damaging 1.00
IGL01090:Usp54 APN 14 20586157 unclassified probably benign
IGL02030:Usp54 APN 14 20565946 missense probably benign 0.44
IGL02333:Usp54 APN 14 20589395 missense probably damaging 1.00
IGL02642:Usp54 APN 14 20565072 splice site probably benign
IGL02970:Usp54 APN 14 20577472 missense probably damaging 1.00
IGL03371:Usp54 APN 14 20589368 unclassified probably benign
BB003:Usp54 UTSW 14 20576968 missense probably damaging 1.00
BB013:Usp54 UTSW 14 20576968 missense probably damaging 1.00
R0050:Usp54 UTSW 14 20573755 unclassified probably benign
R0383:Usp54 UTSW 14 20561252 missense probably benign 0.00
R0427:Usp54 UTSW 14 20570364 missense probably benign
R0442:Usp54 UTSW 14 20607209 missense probably damaging 1.00
R0574:Usp54 UTSW 14 20556254 missense probably benign 0.00
R0638:Usp54 UTSW 14 20589369 unclassified probably benign
R0789:Usp54 UTSW 14 20562157 missense probably benign 0.01
R1272:Usp54 UTSW 14 20561110 missense probably damaging 0.99
R1463:Usp54 UTSW 14 20550190 missense probably benign 0.15
R1565:Usp54 UTSW 14 20607159 missense probably damaging 1.00
R1721:Usp54 UTSW 14 20583440 nonsense probably null
R1922:Usp54 UTSW 14 20560904 missense probably benign 0.00
R2068:Usp54 UTSW 14 20577205 missense probably damaging 1.00
R2216:Usp54 UTSW 14 20561840 missense probably benign
R2285:Usp54 UTSW 14 20561178 missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20564940 missense probably benign 0.00
R3855:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3856:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3907:Usp54 UTSW 14 20586113 missense probably damaging 1.00
R4367:Usp54 UTSW 14 20561134 missense probably benign 0.02
R4384:Usp54 UTSW 14 20550085 splice site probably null
R4555:Usp54 UTSW 14 20561022 missense probably benign 0.06
R4617:Usp54 UTSW 14 20550338 missense probably benign 0.04
R4659:Usp54 UTSW 14 20564992 missense probably damaging 1.00
R4672:Usp54 UTSW 14 20581529 intron probably benign
R4928:Usp54 UTSW 14 20562192 missense probably damaging 1.00
R5381:Usp54 UTSW 14 20586076 missense probably damaging 1.00
R5408:Usp54 UTSW 14 20550433 missense probably damaging 1.00
R5630:Usp54 UTSW 14 20565057 missense probably damaging 1.00
R5841:Usp54 UTSW 14 20550283 missense probably benign 0.04
R5886:Usp54 UTSW 14 20561842 missense probably benign 0.28
R5975:Usp54 UTSW 14 20583351 missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20552099 missense probably benign 0.02
R6183:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R6234:Usp54 UTSW 14 20583450 missense probably damaging 1.00
R6303:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20560869 missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20577228 missense probably damaging 1.00
R6941:Usp54 UTSW 14 20562109 missense probably benign
R7133:Usp54 UTSW 14 20561242 missense probably benign 0.00
R7196:Usp54 UTSW 14 20588370 missense probably damaging 1.00
R7409:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R7424:Usp54 UTSW 14 20577040 missense probably benign 0.15
R7859:Usp54 UTSW 14 20588136 missense probably benign 0.24
R7926:Usp54 UTSW 14 20576968 missense probably damaging 1.00
R7954:Usp54 UTSW 14 20561913 missense probably benign 0.01
RF004:Usp54 UTSW 14 20561300 missense possibly damaging 0.90
X0024:Usp54 UTSW 14 20577251 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCCGAAGAGTGCATTAACCAC -3'
(R):5'- AAAGACTTTGGAAACCGGGC -3'

Sequencing Primer
(F):5'- TTCATGACCCAAGCAGGTTG -3'
(R):5'- GGCACCATTGTTCCAGCTC -3'
Posted On2017-02-28