Incidental Mutation 'R5923:Ntrk3'
ID461675
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Nameneurotrophic tyrosine kinase, receptor, type 3
SynonymsTrkC
MMRRC Submission 043241-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5923 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location78175959-78738012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78451928 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 419 (I419N)
Ref Sequence ENSEMBL: ENSMUSP00000141534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000195262]
Predicted Effect probably benign
Transcript: ENSMUST00000039431
AA Change: I419N

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: I419N

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039438
AA Change: I419N

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146
AA Change: I419N

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 3.1e-8 PFAM
transmembrane domain 429 451 N/A INTRINSIC
PDB:2MFQ|B 497 517 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155795
Predicted Effect possibly damaging
Transcript: ENSMUST00000193002
AA Change: I419N

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: I419N

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195262
AA Change: I419N

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: I419N

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205312
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T G 10: 120,778,770 probably benign Het
Abca9 A G 11: 110,160,552 V106A probably benign Het
Arnt2 G T 7: 84,262,533 T577K probably benign Het
Bod1l G A 5: 41,817,419 T2184I probably damaging Het
Brpf3 G A 17: 28,806,636 V228I possibly damaging Het
Cacna1d T C 14: 30,111,148 N890S probably damaging Het
Cacna1s T A 1: 136,076,822 M120K possibly damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cilp2 A G 8: 69,882,875 F491S probably damaging Het
Cubn A T 2: 13,486,078 S185T possibly damaging Het
Dst T C 1: 34,181,759 S2215P probably benign Het
Echdc3 A G 2: 6,189,572 V224A possibly damaging Het
Hivep3 G T 4: 120,096,293 S602I possibly damaging Het
Itga2 T C 13: 114,884,519 S99G probably benign Het
Kat6a A G 8: 22,939,479 T1617A probably benign Het
Map1b T C 13: 99,433,153 E1020G unknown Het
Nbeal1 T C 1: 60,248,395 F933L probably damaging Het
Nup188 A G 2: 30,304,090 I136V probably benign Het
Olfr885 T A 9: 38,061,858 D179E probably benign Het
Plcb4 A T 2: 135,961,814 K536* probably null Het
Polk A T 13: 96,495,415 I270N probably damaging Het
Prl6a1 A T 13: 27,316,363 M106L probably benign Het
Scap G T 9: 110,383,580 D1027Y probably damaging Het
Spg11 A T 2: 122,093,478 H787Q probably damaging Het
Tatdn3 T C 1: 191,049,310 D215G probably damaging Het
Tbcd G A 11: 121,580,152 C665Y probably benign Het
Tmc8 C T 11: 117,783,812 R118C probably damaging Het
Ttn T A 2: 76,812,557 H13245L probably damaging Het
Unc79 T C 12: 103,112,468 S1631P probably damaging Het
Vmn1r12 G A 6: 57,159,035 G39D probably benign Het
Vmn2r24 A G 6: 123,815,792 S693G probably damaging Het
Zc3h3 G T 15: 75,785,564 R593S probably damaging Het
Zfp598 T C 17: 24,677,549 L200P probably damaging Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 78250873 missense probably benign 0.03
IGL00862:Ntrk3 APN 7 78247177 missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 78247322 missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78450953 missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78460272 splice site probably benign
IGL02175:Ntrk3 APN 7 78247228 missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78462931 missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78453337 missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78451949 missense probably benign
IGL02673:Ntrk3 APN 7 78250764 missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78460439 missense probably benign
IGL02998:Ntrk3 APN 7 78577657 missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 78192592 missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78356014 splice site probably benign
R1505:Ntrk3 UTSW 7 78460524 missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 78247288 missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78356074 missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78356041 missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78477935 splice site probably benign
R1827:Ntrk3 UTSW 7 78247301 missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 78192604 missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78462839 missense probably benign
R1929:Ntrk3 UTSW 7 78516723 splice site probably null
R1941:Ntrk3 UTSW 7 78247262 missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78477935 splice site probably benign
R2214:Ntrk3 UTSW 7 78516772 missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78516723 splice site probably null
R2441:Ntrk3 UTSW 7 78302662 missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3959:Ntrk3 UTSW 7 78198842 missense probably damaging 1.00
R4016:Ntrk3 UTSW 7 78462947 splice site probably benign
R4028:Ntrk3 UTSW 7 78192710 missense probably damaging 1.00
R4067:Ntrk3 UTSW 7 78517437 missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 78250769 nonsense probably null
R4664:Ntrk3 UTSW 7 78461099 missense probably damaging 0.99
R5045:Ntrk3 UTSW 7 78460424 missense probably benign 0.13
R5081:Ntrk3 UTSW 7 78577774 missense probably damaging 0.99
R5151:Ntrk3 UTSW 7 78247300 missense probably damaging 1.00
R5249:Ntrk3 UTSW 7 78461166 missense possibly damaging 0.87
R5294:Ntrk3 UTSW 7 78517506 splice site probably null
R5594:Ntrk3 UTSW 7 78451899 missense probably benign 0.10
R6878:Ntrk3 UTSW 7 78304372 missense probably benign 0.00
R7083:Ntrk3 UTSW 7 78250839 missense probably damaging 1.00
R7178:Ntrk3 UTSW 7 78356147 missense possibly damaging 0.86
R7487:Ntrk3 UTSW 7 78250713 missense probably damaging 1.00
R7607:Ntrk3 UTSW 7 78250873 missense probably benign 0.03
R7800:Ntrk3 UTSW 7 78302740 missense probably benign 0.09
R8009:Ntrk3 UTSW 7 78453328 missense probably benign
R8032:Ntrk3 UTSW 7 78356059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCACTACTGTCAAACAAGG -3'
(R):5'- ATGAGGCAGATAGCTACACTGG -3'

Sequencing Primer
(F):5'- GGACAGTTTAAACCACCTCAAAGG -3'
(R):5'- GGCAGATAGCTACACTGGAACTC -3'
Posted On2017-02-28