Incidental Mutation 'R5923:Cilp2'
ID461680
Institutional Source Beutler Lab
Gene Symbol Cilp2
Ensembl Gene ENSMUSG00000044006
Gene Namecartilage intermediate layer protein 2
Synonyms1110031K21Rik, CLIP-2
MMRRC Submission 043241-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5923 (G1)
Quality Score88
Status Not validated
Chromosome8
Chromosomal Location69880369-69887687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69882875 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 491 (F491S)
Ref Sequence ENSEMBL: ENSMUSP00000061544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057831] [ENSMUST00000152938] [ENSMUST00000180068]
Predicted Effect probably damaging
Transcript: ENSMUST00000057831
AA Change: F491S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061544
Gene: ENSMUSG00000044006
AA Change: F491S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin2_WxxW 58 143 2.5e-22 PFAM
TSP1 149 197 1.33e-9 SMART
Pfam:CarboxypepD_reg 210 288 4.5e-10 PFAM
IGc2 305 367 2.52e-9 SMART
low complexity region 472 481 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 693 703 N/A INTRINSIC
low complexity region 705 719 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152456
Predicted Effect probably benign
Transcript: ENSMUST00000152938
SMART Domains Protein: ENSMUSP00000118931
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:YjeF_N 17 187 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180068
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T G 10: 120,778,770 probably benign Het
Abca9 A G 11: 110,160,552 V106A probably benign Het
Arnt2 G T 7: 84,262,533 T577K probably benign Het
Bod1l G A 5: 41,817,419 T2184I probably damaging Het
Brpf3 G A 17: 28,806,636 V228I possibly damaging Het
Cacna1d T C 14: 30,111,148 N890S probably damaging Het
Cacna1s T A 1: 136,076,822 M120K possibly damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cubn A T 2: 13,486,078 S185T possibly damaging Het
Dst T C 1: 34,181,759 S2215P probably benign Het
Echdc3 A G 2: 6,189,572 V224A possibly damaging Het
Hivep3 G T 4: 120,096,293 S602I possibly damaging Het
Itga2 T C 13: 114,884,519 S99G probably benign Het
Kat6a A G 8: 22,939,479 T1617A probably benign Het
Map1b T C 13: 99,433,153 E1020G unknown Het
Nbeal1 T C 1: 60,248,395 F933L probably damaging Het
Ntrk3 A T 7: 78,451,928 I419N possibly damaging Het
Nup188 A G 2: 30,304,090 I136V probably benign Het
Olfr885 T A 9: 38,061,858 D179E probably benign Het
Plcb4 A T 2: 135,961,814 K536* probably null Het
Polk A T 13: 96,495,415 I270N probably damaging Het
Prl6a1 A T 13: 27,316,363 M106L probably benign Het
Scap G T 9: 110,383,580 D1027Y probably damaging Het
Spg11 A T 2: 122,093,478 H787Q probably damaging Het
Tatdn3 T C 1: 191,049,310 D215G probably damaging Het
Tbcd G A 11: 121,580,152 C665Y probably benign Het
Tmc8 C T 11: 117,783,812 R118C probably damaging Het
Ttn T A 2: 76,812,557 H13245L probably damaging Het
Unc79 T C 12: 103,112,468 S1631P probably damaging Het
Vmn1r12 G A 6: 57,159,035 G39D probably benign Het
Vmn2r24 A G 6: 123,815,792 S693G probably damaging Het
Zc3h3 G T 15: 75,785,564 R593S probably damaging Het
Zfp598 T C 17: 24,677,549 L200P probably damaging Het
Other mutations in Cilp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Cilp2 APN 8 69882846 missense probably damaging 0.96
IGL01538:Cilp2 APN 8 69881204 missense probably benign 0.13
IGL02063:Cilp2 APN 8 69882865 missense probably damaging 1.00
IGL02582:Cilp2 APN 8 69881286 missense probably damaging 1.00
IGL02892:Cilp2 APN 8 69884320 missense probably benign 0.02
R0308:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0371:Cilp2 UTSW 8 69881606 missense probably damaging 1.00
R0413:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0414:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0470:Cilp2 UTSW 8 69885405 missense possibly damaging 0.87
R0838:Cilp2 UTSW 8 69881719 missense probably benign 0.04
R0842:Cilp2 UTSW 8 69883118 missense probably damaging 1.00
R1807:Cilp2 UTSW 8 69882194 missense probably damaging 1.00
R1864:Cilp2 UTSW 8 69881323 missense probably damaging 1.00
R2010:Cilp2 UTSW 8 69881694 missense probably damaging 1.00
R2104:Cilp2 UTSW 8 69882792 nonsense probably null
R2339:Cilp2 UTSW 8 69882894 missense probably benign 0.04
R4572:Cilp2 UTSW 8 69882410 missense probably damaging 1.00
R5225:Cilp2 UTSW 8 69883365 missense probably damaging 1.00
R6113:Cilp2 UTSW 8 69882359 missense probably benign 0.00
R6958:Cilp2 UTSW 8 69882540 missense probably benign 0.01
R7108:Cilp2 UTSW 8 69881129 missense probably damaging 1.00
R7454:Cilp2 UTSW 8 69883390 missense probably damaging 1.00
R7455:Cilp2 UTSW 8 69881071 missense probably damaging 1.00
R7598:Cilp2 UTSW 8 69886032 missense probably benign 0.29
R7736:Cilp2 UTSW 8 69881421 missense probably damaging 1.00
R7781:Cilp2 UTSW 8 69882347 missense possibly damaging 0.81
Z1088:Cilp2 UTSW 8 69885410 missense possibly damaging 0.94
Z1177:Cilp2 UTSW 8 69882808 missense probably damaging 0.99
Z1177:Cilp2 UTSW 8 69884542 missense probably damaging 1.00
Z1177:Cilp2 UTSW 8 69884546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGAAAGTGACACGAGCCTC -3'
(R):5'- GGAACACCTGATCAAGCTTCC -3'

Sequencing Primer
(F):5'- GCGTCCAACAGCACTGC -3'
(R):5'- ATCAAGCTTCCGGACGATTG -3'
Posted On2017-02-28