Incidental Mutation 'R5923:Prl6a1'
ID461689
Institutional Source Beutler Lab
Gene Symbol Prl6a1
Ensembl Gene ENSMUSG00000069259
Gene Nameprolactin family 6, subfamily a, member 1
SynonymsPLP-B, Prlpb
MMRRC Submission 043241-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5923 (G1)
Quality Score200
Status Not validated
Chromosome13
Chromosomal Location27312627-27319252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27316363 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 106 (M106L)
Ref Sequence ENSEMBL: ENSMUSP00000089269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091679] [ENSMUST00000091680]
Predicted Effect probably benign
Transcript: ENSMUST00000091679
AA Change: M111L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000089268
Gene: ENSMUSG00000069259
AA Change: M111L

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Hormone_1 21 235 8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091680
AA Change: M106L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000089269
Gene: ENSMUSG00000069259
AA Change: M106L

DomainStartEndE-ValueType
Pfam:Hormone_1 16 230 1.1e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119758
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T G 10: 120,778,770 probably benign Het
Abca9 A G 11: 110,160,552 V106A probably benign Het
Arnt2 G T 7: 84,262,533 T577K probably benign Het
Bod1l G A 5: 41,817,419 T2184I probably damaging Het
Brpf3 G A 17: 28,806,636 V228I possibly damaging Het
Cacna1d T C 14: 30,111,148 N890S probably damaging Het
Cacna1s T A 1: 136,076,822 M120K possibly damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cilp2 A G 8: 69,882,875 F491S probably damaging Het
Cubn A T 2: 13,486,078 S185T possibly damaging Het
Dst T C 1: 34,181,759 S2215P probably benign Het
Echdc3 A G 2: 6,189,572 V224A possibly damaging Het
Hivep3 G T 4: 120,096,293 S602I possibly damaging Het
Itga2 T C 13: 114,884,519 S99G probably benign Het
Kat6a A G 8: 22,939,479 T1617A probably benign Het
Map1b T C 13: 99,433,153 E1020G unknown Het
Nbeal1 T C 1: 60,248,395 F933L probably damaging Het
Ntrk3 A T 7: 78,451,928 I419N possibly damaging Het
Nup188 A G 2: 30,304,090 I136V probably benign Het
Olfr885 T A 9: 38,061,858 D179E probably benign Het
Plcb4 A T 2: 135,961,814 K536* probably null Het
Polk A T 13: 96,495,415 I270N probably damaging Het
Scap G T 9: 110,383,580 D1027Y probably damaging Het
Spg11 A T 2: 122,093,478 H787Q probably damaging Het
Tatdn3 T C 1: 191,049,310 D215G probably damaging Het
Tbcd G A 11: 121,580,152 C665Y probably benign Het
Tmc8 C T 11: 117,783,812 R118C probably damaging Het
Ttn T A 2: 76,812,557 H13245L probably damaging Het
Unc79 T C 12: 103,112,468 S1631P probably damaging Het
Vmn1r12 G A 6: 57,159,035 G39D probably benign Het
Vmn2r24 A G 6: 123,815,792 S693G probably damaging Het
Zc3h3 G T 15: 75,785,564 R593S probably damaging Het
Zfp598 T C 17: 24,677,549 L200P probably damaging Het
Other mutations in Prl6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Prl6a1 APN 13 27316364 missense possibly damaging 0.72
IGL01688:Prl6a1 APN 13 27317986 missense probably damaging 1.00
IGL01922:Prl6a1 APN 13 27315360 missense possibly damaging 0.57
IGL02059:Prl6a1 APN 13 27315365 missense probably benign 0.02
IGL03170:Prl6a1 APN 13 27315423 missense possibly damaging 0.95
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0027:Prl6a1 UTSW 13 27318028 missense probably damaging 1.00
R0049:Prl6a1 UTSW 13 27317997 missense probably damaging 0.99
R0606:Prl6a1 UTSW 13 27314194 intron probably benign
R0944:Prl6a1 UTSW 13 27318166 splice site probably benign
R1518:Prl6a1 UTSW 13 27318927 missense possibly damaging 0.72
R1518:Prl6a1 UTSW 13 27318928 missense probably null 0.19
R1566:Prl6a1 UTSW 13 27315427 missense possibly damaging 0.84
R1621:Prl6a1 UTSW 13 27318010 missense probably benign 0.01
R2011:Prl6a1 UTSW 13 27315369 missense probably benign 0.00
R2058:Prl6a1 UTSW 13 27319098 missense probably benign 0.05
R2937:Prl6a1 UTSW 13 27315320 missense probably damaging 0.98
R3079:Prl6a1 UTSW 13 27319000 missense possibly damaging 0.71
R4685:Prl6a1 UTSW 13 27316324 missense probably benign 0.00
R4856:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R4886:Prl6a1 UTSW 13 27319000 missense probably damaging 0.98
R5495:Prl6a1 UTSW 13 27312671 missense possibly damaging 0.95
R6772:Prl6a1 UTSW 13 27319048 missense probably damaging 1.00
R7411:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R7501:Prl6a1 UTSW 13 27316299 missense possibly damaging 0.69
R7549:Prl6a1 UTSW 13 27318971 missense probably damaging 0.96
R7563:Prl6a1 UTSW 13 27314238 critical splice donor site probably null
R7773:Prl6a1 UTSW 13 27318142 missense probably damaging 1.00
R8024:Prl6a1 UTSW 13 27318695 intron probably benign
Z1177:Prl6a1 UTSW 13 27315321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGATGACACTCACATTCAC -3'
(R):5'- GCACAATTTATGGTTCTAAGACAGC -3'

Sequencing Primer
(F):5'- TTGCAAAAACCTGCCTGTG -3'
(R):5'- TGGTTCTAAGACAGCATTCTTTAATC -3'
Posted On2017-02-28