Incidental Mutation 'R5923:Zfp598'
ID461696
Institutional Source Beutler Lab
Gene Symbol Zfp598
Ensembl Gene ENSMUSG00000041130
Gene Namezinc finger protein 598
Synonyms
MMRRC Submission 043241-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5923 (G1)
Quality Score159
Status Not validated
Chromosome17
Chromosomal Location24669752-24682015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24677549 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 200 (L200P)
Ref Sequence ENSEMBL: ENSMUSP00000038367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047179]
Predicted Effect probably damaging
Transcript: ENSMUST00000047179
AA Change: L200P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130
AA Change: L200P

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513I03Rik T G 10: 120,778,770 probably benign Het
Abca9 A G 11: 110,160,552 V106A probably benign Het
Arnt2 G T 7: 84,262,533 T577K probably benign Het
Bod1l G A 5: 41,817,419 T2184I probably damaging Het
Brpf3 G A 17: 28,806,636 V228I possibly damaging Het
Cacna1d T C 14: 30,111,148 N890S probably damaging Het
Cacna1s T A 1: 136,076,822 M120K possibly damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cilp2 A G 8: 69,882,875 F491S probably damaging Het
Cubn A T 2: 13,486,078 S185T possibly damaging Het
Dst T C 1: 34,181,759 S2215P probably benign Het
Echdc3 A G 2: 6,189,572 V224A possibly damaging Het
Hivep3 G T 4: 120,096,293 S602I possibly damaging Het
Itga2 T C 13: 114,884,519 S99G probably benign Het
Kat6a A G 8: 22,939,479 T1617A probably benign Het
Map1b T C 13: 99,433,153 E1020G unknown Het
Nbeal1 T C 1: 60,248,395 F933L probably damaging Het
Ntrk3 A T 7: 78,451,928 I419N possibly damaging Het
Nup188 A G 2: 30,304,090 I136V probably benign Het
Olfr885 T A 9: 38,061,858 D179E probably benign Het
Plcb4 A T 2: 135,961,814 K536* probably null Het
Polk A T 13: 96,495,415 I270N probably damaging Het
Prl6a1 A T 13: 27,316,363 M106L probably benign Het
Scap G T 9: 110,383,580 D1027Y probably damaging Het
Spg11 A T 2: 122,093,478 H787Q probably damaging Het
Tatdn3 T C 1: 191,049,310 D215G probably damaging Het
Tbcd G A 11: 121,580,152 C665Y probably benign Het
Tmc8 C T 11: 117,783,812 R118C probably damaging Het
Ttn T A 2: 76,812,557 H13245L probably damaging Het
Unc79 T C 12: 103,112,468 S1631P probably damaging Het
Vmn1r12 G A 6: 57,159,035 G39D probably benign Het
Vmn2r24 A G 6: 123,815,792 S693G probably damaging Het
Zc3h3 G T 15: 75,785,564 R593S probably damaging Het
Other mutations in Zfp598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zfp598 APN 17 24681424 unclassified probably benign
IGL02118:Zfp598 APN 17 24677617 missense probably damaging 1.00
IGL02178:Zfp598 APN 17 24677543 missense probably damaging 1.00
IGL02591:Zfp598 APN 17 24677504 missense probably damaging 1.00
IGL03061:Zfp598 APN 17 24679592 missense probably benign 0.03
FR4304:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4340:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4340:Zfp598 UTSW 17 24680783 small insertion probably benign
FR4342:Zfp598 UTSW 17 24680780 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680785 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4589:Zfp598 UTSW 17 24680779 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680782 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680791 small insertion probably benign
FR4976:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4976:Zfp598 UTSW 17 24680782 small insertion probably benign
R0309:Zfp598 UTSW 17 24678584 splice site probably benign
R1295:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1296:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1471:Zfp598 UTSW 17 24680072 missense probably benign 0.00
R1523:Zfp598 UTSW 17 24678629 missense probably null 1.00
R1819:Zfp598 UTSW 17 24681130 unclassified probably benign
R2001:Zfp598 UTSW 17 24669924 missense possibly damaging 0.94
R2080:Zfp598 UTSW 17 24679667 missense probably damaging 1.00
R4447:Zfp598 UTSW 17 24676555 missense probably damaging 1.00
R5086:Zfp598 UTSW 17 24680898 unclassified probably benign
R6191:Zfp598 UTSW 17 24677876 missense possibly damaging 0.89
R6680:Zfp598 UTSW 17 24678686 missense probably benign 0.06
R7438:Zfp598 UTSW 17 24677530 missense probably damaging 1.00
R7870:Zfp598 UTSW 17 24679330 missense probably damaging 0.98
RF009:Zfp598 UTSW 17 24680787 small insertion probably benign
RF016:Zfp598 UTSW 17 24680771 small insertion probably benign
RF018:Zfp598 UTSW 17 24680771 small insertion probably benign
RF053:Zfp598 UTSW 17 24680761 small insertion probably benign
RF058:Zfp598 UTSW 17 24680761 small insertion probably benign
RF061:Zfp598 UTSW 17 24680770 small insertion probably benign
RF064:Zfp598 UTSW 17 24680783 small insertion probably benign
Z1088:Zfp598 UTSW 17 24680210 small insertion probably benign
Z1177:Zfp598 UTSW 17 24679639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCGAAGTCAGGAGGTTG -3'
(R):5'- AAGTCCTAGGAGAGAATCACCG -3'

Sequencing Primer
(F):5'- TCAGGAGGTTGGGAGCC -3'
(R):5'- CTAGGAGAGAATCACCGAGGCAC -3'
Posted On2017-02-28