Incidental Mutation 'R5924:Epha5'
ID461716
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission 044119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5924 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 84233674 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 439 (Y439*)
Ref Sequence ENSEMBL: ENSMUSP00000109033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect probably benign
Transcript: ENSMUST00000053733
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113398
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113399
AA Change: Y439*
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: Y439*

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113401
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113403
AA Change: Y439*
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: Y439*

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113406
AA Change: Y439*
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: Y439*

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155469
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,706,085 Y76C probably damaging Het
Agbl1 C T 7: 76,409,234 T204I probably benign Het
Apc2 A T 10: 80,312,150 I984F probably damaging Het
Art3 A T 5: 92,412,232 probably benign Het
B4galnt4 A G 7: 141,070,829 M839V probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cdhr2 A C 13: 54,726,683 D856A probably benign Het
Cep78 A T 19: 15,961,066 L506Q probably damaging Het
Col6a1 A G 10: 76,718,371 probably null Het
Cyp3a44 A T 5: 145,794,327 F221Y possibly damaging Het
Dcakd C A 11: 102,999,820 R47L probably benign Het
Ddr2 A G 1: 169,994,628 V417A probably benign Het
Dnah5 A T 15: 28,307,327 T1734S probably benign Het
Eefsec A T 6: 88,355,547 M227K probably damaging Het
Eif4g3 T G 4: 138,201,926 N1628K probably damaging Het
Esrp1 G T 4: 11,361,174 T324K probably damaging Het
Flnb T A 14: 7,890,765 M549K probably benign Het
Fndc1 T A 17: 7,773,610 Q418L unknown Het
Ggnbp2 A G 11: 84,858,537 S144P possibly damaging Het
Gk5 T C 9: 96,150,510 probably null Het
Gpr137 A G 19: 6,939,361 L228P probably damaging Het
Gpt2 C A 8: 85,493,004 S26R probably damaging Het
Hras C T 7: 141,192,461 E91K possibly damaging Het
Ighv1-36 G A 12: 114,880,157 P28S possibly damaging Het
Kalrn G A 16: 34,243,833 T807M probably damaging Het
Lifr A G 15: 7,172,972 T365A probably benign Het
Lpin1 A T 12: 16,544,657 S795T possibly damaging Het
Magi2 A C 5: 20,611,069 M1128L probably benign Het
Magi3 A T 3: 104,054,538 probably null Het
Mier1 T A 4: 103,159,702 L380* probably null Het
Mtmr14 A G 6: 113,253,789 Y118C probably damaging Het
Myof A T 19: 37,982,973 M277K probably damaging Het
Nlrp6 T C 7: 140,923,490 V473A probably damaging Het
Nsfl1c T A 2: 151,505,400 N164K probably benign Het
Olfm3 A T 3: 115,122,538 Q353L probably benign Het
Olfr1170 T C 2: 88,224,547 I162V probably benign Het
Olfr131 A G 17: 38,082,363 V205A probably benign Het
Olfr727 A G 14: 50,126,682 Y35C probably damaging Het
Opn5 A T 17: 42,611,308 M1K probably null Het
Pax8 A G 2: 24,421,622 S434P probably damaging Het
Pigo G A 4: 43,023,389 Q256* probably null Het
Pik3ap1 A C 19: 41,296,456 F597V probably damaging Het
Pkd2 A G 5: 104,498,558 K744E probably damaging Het
Prom1 T C 5: 44,004,963 T729A probably benign Het
Rasal1 T C 5: 120,675,517 L652P probably damaging Het
Sebox T C 11: 78,504,191 probably null Het
Setd2 A T 9: 110,574,044 I1918F probably benign Het
Slc24a2 A T 4: 87,011,588 probably null Het
Slc28a1 G T 7: 81,115,612 G25V probably benign Het
Slc51a A G 16: 32,477,172 F259L possibly damaging Het
Slco2a1 T A 9: 103,046,699 C37* probably null Het
Speer4f2 A G 5: 17,376,624 D188G probably damaging Het
Stim2 A G 5: 54,102,643 K156E probably benign Het
Strn4 T C 7: 16,838,321 I653T probably damaging Het
Tacr3 G T 3: 134,932,299 D406Y possibly damaging Het
Utp20 G A 10: 88,815,922 R400C probably benign Het
V1rd19 C T 7: 24,003,949 S280L probably benign Het
Vmn2r4 C T 3: 64,389,264 C700Y probably damaging Het
Zufsp A T 10: 33,927,547 C514S probably damaging Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 intron probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5422:Epha5 UTSW 5 84331490 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
R8043:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTAGGTCTACTCCTCAGCTGTAG -3'
(R):5'- CCTCGGAATGCCATCTCAAATG -3'

Sequencing Primer
(F):5'- CTCAGCTGTAGATTCAATCGGCAG -3'
(R):5'- AGTGGATTCCGCCTGCTGAC -3'
Posted On2017-02-28