Incidental Mutation 'R5924:Mtmr14'
ID461722
Institutional Source Beutler Lab
Gene Symbol Mtmr14
Ensembl Gene ENSMUSG00000030269
Gene Namemyotubularin related protein 14
Synonyms
MMRRC Submission 044119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5924 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113237843-113281392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113253789 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 118 (Y118C)
Ref Sequence ENSEMBL: ENSMUSP00000116918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113146] [ENSMUST00000129883] [ENSMUST00000142938] [ENSMUST00000156141] [ENSMUST00000203385]
Predicted Effect probably damaging
Transcript: ENSMUST00000113146
AA Change: Y158C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108771
Gene: ENSMUSG00000030269
AA Change: Y158C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:C2 605 647 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000129883
AA Change: Y158C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114575
Gene: ENSMUSG00000030269
AA Change: Y158C

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142938
SMART Domains Protein: ENSMUSP00000121136
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144976
Predicted Effect probably damaging
Transcript: ENSMUST00000156141
AA Change: Y118C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000203385
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired coordination, decreased exercise endurance, increased muscle fatigue, and muscle atrophy associated with impaired muscular calcium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,706,085 Y76C probably damaging Het
Agbl1 C T 7: 76,409,234 T204I probably benign Het
Apc2 A T 10: 80,312,150 I984F probably damaging Het
Art3 A T 5: 92,412,232 probably benign Het
B4galnt4 A G 7: 141,070,829 M839V probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cdhr2 A C 13: 54,726,683 D856A probably benign Het
Cep78 A T 19: 15,961,066 L506Q probably damaging Het
Col6a1 A G 10: 76,718,371 probably null Het
Cyp3a44 A T 5: 145,794,327 F221Y possibly damaging Het
Dcakd C A 11: 102,999,820 R47L probably benign Het
Ddr2 A G 1: 169,994,628 V417A probably benign Het
Dnah5 A T 15: 28,307,327 T1734S probably benign Het
Eefsec A T 6: 88,355,547 M227K probably damaging Het
Eif4g3 T G 4: 138,201,926 N1628K probably damaging Het
Epha5 A T 5: 84,233,674 Y439* probably null Het
Esrp1 G T 4: 11,361,174 T324K probably damaging Het
Flnb T A 14: 7,890,765 M549K probably benign Het
Fndc1 T A 17: 7,773,610 Q418L unknown Het
Ggnbp2 A G 11: 84,858,537 S144P possibly damaging Het
Gk5 T C 9: 96,150,510 probably null Het
Gpr137 A G 19: 6,939,361 L228P probably damaging Het
Gpt2 C A 8: 85,493,004 S26R probably damaging Het
Hras C T 7: 141,192,461 E91K possibly damaging Het
Ighv1-36 G A 12: 114,880,157 P28S possibly damaging Het
Kalrn G A 16: 34,243,833 T807M probably damaging Het
Lifr A G 15: 7,172,972 T365A probably benign Het
Lpin1 A T 12: 16,544,657 S795T possibly damaging Het
Magi2 A C 5: 20,611,069 M1128L probably benign Het
Magi3 A T 3: 104,054,538 probably null Het
Mier1 T A 4: 103,159,702 L380* probably null Het
Myof A T 19: 37,982,973 M277K probably damaging Het
Nlrp6 T C 7: 140,923,490 V473A probably damaging Het
Nsfl1c T A 2: 151,505,400 N164K probably benign Het
Olfm3 A T 3: 115,122,538 Q353L probably benign Het
Olfr1170 T C 2: 88,224,547 I162V probably benign Het
Olfr131 A G 17: 38,082,363 V205A probably benign Het
Olfr727 A G 14: 50,126,682 Y35C probably damaging Het
Opn5 A T 17: 42,611,308 M1K probably null Het
Pax8 A G 2: 24,421,622 S434P probably damaging Het
Pigo G A 4: 43,023,389 Q256* probably null Het
Pik3ap1 A C 19: 41,296,456 F597V probably damaging Het
Pkd2 A G 5: 104,498,558 K744E probably damaging Het
Prom1 T C 5: 44,004,963 T729A probably benign Het
Rasal1 T C 5: 120,675,517 L652P probably damaging Het
Sebox T C 11: 78,504,191 probably null Het
Setd2 A T 9: 110,574,044 I1918F probably benign Het
Slc24a2 A T 4: 87,011,588 probably null Het
Slc28a1 G T 7: 81,115,612 G25V probably benign Het
Slc51a A G 16: 32,477,172 F259L possibly damaging Het
Slco2a1 T A 9: 103,046,699 C37* probably null Het
Speer4f2 A G 5: 17,376,624 D188G probably damaging Het
Stim2 A G 5: 54,102,643 K156E probably benign Het
Strn4 T C 7: 16,838,321 I653T probably damaging Het
Tacr3 G T 3: 134,932,299 D406Y possibly damaging Het
Utp20 G A 10: 88,815,922 R400C probably benign Het
V1rd19 C T 7: 24,003,949 S280L probably benign Het
Vmn2r4 C T 3: 64,389,264 C700Y probably damaging Het
Zufsp A T 10: 33,927,547 C514S probably damaging Het
Other mutations in Mtmr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Mtmr14 APN 6 113266326 missense probably damaging 0.98
IGL01686:Mtmr14 APN 6 113240430 missense possibly damaging 0.58
IGL02508:Mtmr14 APN 6 113240306 missense probably damaging 1.00
R0147:Mtmr14 UTSW 6 113260666 splice site probably benign
R0394:Mtmr14 UTSW 6 113280688 nonsense probably null
R0529:Mtmr14 UTSW 6 113266252 unclassified probably benign
R0675:Mtmr14 UTSW 6 113270647 missense probably damaging 0.99
R0723:Mtmr14 UTSW 6 113270512 unclassified probably benign
R0785:Mtmr14 UTSW 6 113277947 critical splice donor site probably null
R0866:Mtmr14 UTSW 6 113239582 critical splice donor site probably null
R1721:Mtmr14 UTSW 6 113253732 missense probably damaging 1.00
R1998:Mtmr14 UTSW 6 113277924 missense probably null
R2063:Mtmr14 UTSW 6 113240361 missense probably damaging 1.00
R2192:Mtmr14 UTSW 6 113280739 missense probably damaging 1.00
R2656:Mtmr14 UTSW 6 113240366 missense probably benign 0.03
R4648:Mtmr14 UTSW 6 113260606 missense probably benign 0.12
R5209:Mtmr14 UTSW 6 113253775 nonsense probably null
R5509:Mtmr14 UTSW 6 113253807 critical splice donor site probably null
R5569:Mtmr14 UTSW 6 113240285 missense probably damaging 0.96
R5589:Mtmr14 UTSW 6 113261282 critical splice donor site probably null
R5997:Mtmr14 UTSW 6 113280614 missense probably damaging 0.97
R6182:Mtmr14 UTSW 6 113269508 missense possibly damaging 0.78
R6658:Mtmr14 UTSW 6 113265476 nonsense probably null
R6752:Mtmr14 UTSW 6 113240397 missense probably damaging 1.00
R7325:Mtmr14 UTSW 6 113269548 missense probably damaging 0.98
R7512:Mtmr14 UTSW 6 113268691 nonsense probably null
R7816:Mtmr14 UTSW 6 113266302 missense probably damaging 1.00
X0023:Mtmr14 UTSW 6 113261255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTTGAGACTGACTGGGGTG -3'
(R):5'- TCAGCCCTCAAGTCTCCATTAG -3'

Sequencing Primer
(F):5'- GGTCTCTATGCTGGTAAGAAGC -3'
(R):5'- TCAAGTCTCCATTAGGGCCAC -3'
Posted On2017-02-28