Mutagenetix > Incidental Mutation

Incidental Mutation 'R5924:Agbl1'

461725

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

MMRRC Submission

044119-MU

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5924 (G1)

Quality Score

194

Status

Not validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76409234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 204 (T204I)

Ref Sequence

ENSEMBL: ENSMUSP00000119721 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026854

SMART Domains

Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	493	631	4.4e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107442

SMART Domains

Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	494	754	3.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156166
AA Change: T204I

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: T204I

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd3	T	C	18: 10,706,085	Y76C	probably damaging	Het
Apc2	A	T	10: 80,312,150	I984F	probably damaging	Het
Art3	A	T	5: 92,412,232		probably benign	Het
B4galnt4	A	G	7: 141,070,829	M839V	probably damaging	Het
Bnip2	A	G	9: 69,997,162	D67G	probably benign	Het
Cdhr2	A	C	13: 54,726,683	D856A	probably benign	Het
Cep78	A	T	19: 15,961,066	L506Q	probably damaging	Het
Col6a1	A	G	10: 76,718,371		probably null	Het
Cyp3a44	A	T	5: 145,794,327	F221Y	possibly damaging	Het
Dcakd	C	A	11: 102,999,820	R47L	probably benign	Het
Ddr2	A	G	1: 169,994,628	V417A	probably benign	Het
Dnah5	A	T	15: 28,307,327	T1734S	probably benign	Het
Eefsec	A	T	6: 88,355,547	M227K	probably damaging	Het
Eif4g3	T	G	4: 138,201,926	N1628K	probably damaging	Het
Epha5	A	T	5: 84,233,674	Y439*	probably null	Het
Esrp1	G	T	4: 11,361,174	T324K	probably damaging	Het
Flnb	T	A	14: 7,890,765	M549K	probably benign	Het
Fndc1	T	A	17: 7,773,610	Q418L	unknown	Het
Ggnbp2	A	G	11: 84,858,537	S144P	possibly damaging	Het
Gk5	T	C	9: 96,150,510		probably null	Het
Gpr137	A	G	19: 6,939,361	L228P	probably damaging	Het
Gpt2	C	A	8: 85,493,004	S26R	probably damaging	Het
Hras	C	T	7: 141,192,461	E91K	possibly damaging	Het
Ighv1-36	G	A	12: 114,880,157	P28S	possibly damaging	Het
Kalrn	G	A	16: 34,243,833	T807M	probably damaging	Het
Lifr	A	G	15: 7,172,972	T365A	probably benign	Het
Lpin1	A	T	12: 16,544,657	S795T	possibly damaging	Het
Magi2	A	C	5: 20,611,069	M1128L	probably benign	Het
Magi3	A	T	3: 104,054,538		probably null	Het
Mier1	T	A	4: 103,159,702	L380*	probably null	Het
Mtmr14	A	G	6: 113,253,789	Y118C	probably damaging	Het
Myof	A	T	19: 37,982,973	M277K	probably damaging	Het
Nlrp6	T	C	7: 140,923,490	V473A	probably damaging	Het
Nsfl1c	T	A	2: 151,505,400	N164K	probably benign	Het
Olfm3	A	T	3: 115,122,538	Q353L	probably benign	Het
Olfr1170	T	C	2: 88,224,547	I162V	probably benign	Het
Olfr131	A	G	17: 38,082,363	V205A	probably benign	Het
Olfr727	A	G	14: 50,126,682	Y35C	probably damaging	Het
Opn5	A	T	17: 42,611,308	M1K	probably null	Het
Pax8	A	G	2: 24,421,622	S434P	probably damaging	Het
Pigo	G	A	4: 43,023,389	Q256*	probably null	Het
Pik3ap1	A	C	19: 41,296,456	F597V	probably damaging	Het
Pkd2	A	G	5: 104,498,558	K744E	probably damaging	Het
Prom1	T	C	5: 44,004,963	T729A	probably benign	Het
Rasal1	T	C	5: 120,675,517	L652P	probably damaging	Het
Sebox	T	C	11: 78,504,191		probably null	Het
Setd2	A	T	9: 110,574,044	I1918F	probably benign	Het
Slc24a2	A	T	4: 87,011,588		probably null	Het
Slc28a1	G	T	7: 81,115,612	G25V	probably benign	Het
Slc51a	A	G	16: 32,477,172	F259L	possibly damaging	Het
Slco2a1	T	A	9: 103,046,699	C37*	probably null	Het
Speer4f2	A	G	5: 17,376,624	D188G	probably damaging	Het
Stim2	A	G	5: 54,102,643	K156E	probably benign	Het
Strn4	T	C	7: 16,838,321	I653T	probably damaging	Het
Tacr3	G	T	3: 134,932,299	D406Y	possibly damaging	Het
Utp20	G	A	10: 88,815,922	R400C	probably benign	Het
V1rd19	C	T	7: 24,003,949	S280L	probably benign	Het
Vmn2r4	C	T	3: 64,389,264	C700Y	probably damaging	Het
Zufsp	A	T	10: 33,927,547	C514S	probably damaging	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0001:Agbl1	UTSW	7	76419863	missense	probably damaging	0.98
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2127:Agbl1	UTSW	7	76419880	missense	possibly damaging	0.64
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5095:Agbl1	UTSW	7	76720133	missense	probably damaging	0.96
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5849:Agbl1	UTSW	7	76325098	missense	probably benign	0.35
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6117:Agbl1	UTSW	7	76698786	missense	probably damaging	1.00
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7516:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
R7981:Agbl1	UTSW	7	76444840	missense	unknown
R8208:Agbl1	UTSW	7	76720168	missense	unknown
R8317:Agbl1	UTSW	7	76422181	missense	unknown
R8406:Agbl1	UTSW	7	76418667	missense
R8432:Agbl1	UTSW	7	77124686	missense	unknown
R8704:Agbl1	UTSW	7	76589554	splice site	probably benign
R8830:Agbl1	UTSW	7	76335311	missense
R8985:Agbl1	UTSW	7	76320156	missense
R9113:Agbl1	UTSW	7	76589477	missense	unknown
R9170:Agbl1	UTSW	7	76335321	missense
R9229:Agbl1	UTSW	7	77124522	missense	unknown
R9255:Agbl1	UTSW	7	76766402	missense	unknown
R9391:Agbl1	UTSW	7	76421854	missense	unknown
R9646:Agbl1	UTSW	7	76425900	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AACACCTGCCAGTTTTATATGCTG -3'
(R):5'- AAGTCTTGGAGCATCACCCAG -3'

Sequencing Primer
(F):5'- ACCTGCCAGTTTTATATGCTGAACTG -3'
(R):5'- GAAACCATCCACCTGCTGTG -3'

Posted On

2017-02-28