Mutagenetix > Incidental Mutation

Incidental Mutation 'R5924:Nlrp6'

461727

Institutional Source

Beutler Lab

Gene Symbol

Nlrp6

Ensembl Gene

ENSMUSG00000038745

Gene Name

NLR family, pyrin domain containing 6

Synonyms

Nalp6

MMRRC Submission

044119-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R5924 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140920902-140929192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140923490 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 473 (V473A)

Ref Sequence

ENSEMBL: ENSMUSP00000139357 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]

AlphaFold

Q91WS2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106045
AA Change: V473A

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: V473A

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	8.6e-44	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	675	697	N/A	INTRINSIC
internal_repeat_1	715	763	9.43e-6	PROSPERO
internal_repeat_1	828	876	9.43e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183761

Predicted Effect

probably damaging
Transcript: ENSMUST00000183845
AA Change: V473A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: V473A

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	5.5e-43	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	680	694	N/A	INTRINSIC
internal_repeat_1	702	750	1.26e-5	PROSPERO
internal_repeat_1	815	863	1.26e-5	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000184560
AA Change: V503A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: V503A

Domain	Start	End	E-Value	Type
PYRIN	45	126	5.44e-27	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:NACHT	224	393	8.2e-43	PFAM
coiled coil region	620	647	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
internal_repeat_1	732	780	1.55e-5	PROSPERO
internal_repeat_1	845	893	1.55e-5	PROSPERO

Coding Region Coverage

1x: 99.8%
3x: 99.5%
10x: 97.6%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd3	T	C	18: 10,706,085	Y76C	probably damaging	Het
Agbl1	C	T	7: 76,409,234	T204I	probably benign	Het
Apc2	A	T	10: 80,312,150	I984F	probably damaging	Het
Art3	A	T	5: 92,412,232		probably benign	Het
B4galnt4	A	G	7: 141,070,829	M839V	probably damaging	Het
Bnip2	A	G	9: 69,997,162	D67G	probably benign	Het
Cdhr2	A	C	13: 54,726,683	D856A	probably benign	Het
Cep78	A	T	19: 15,961,066	L506Q	probably damaging	Het
Col6a1	A	G	10: 76,718,371		probably null	Het
Cyp3a44	A	T	5: 145,794,327	F221Y	possibly damaging	Het
Dcakd	C	A	11: 102,999,820	R47L	probably benign	Het
Ddr2	A	G	1: 169,994,628	V417A	probably benign	Het
Dnah5	A	T	15: 28,307,327	T1734S	probably benign	Het
Eefsec	A	T	6: 88,355,547	M227K	probably damaging	Het
Eif4g3	T	G	4: 138,201,926	N1628K	probably damaging	Het
Epha5	A	T	5: 84,233,674	Y439*	probably null	Het
Esrp1	G	T	4: 11,361,174	T324K	probably damaging	Het
Flnb	T	A	14: 7,890,765	M549K	probably benign	Het
Fndc1	T	A	17: 7,773,610	Q418L	unknown	Het
Ggnbp2	A	G	11: 84,858,537	S144P	possibly damaging	Het
Gk5	T	C	9: 96,150,510		probably null	Het
Gpr137	A	G	19: 6,939,361	L228P	probably damaging	Het
Gpt2	C	A	8: 85,493,004	S26R	probably damaging	Het
Hras	C	T	7: 141,192,461	E91K	possibly damaging	Het
Ighv1-36	G	A	12: 114,880,157	P28S	possibly damaging	Het
Kalrn	G	A	16: 34,243,833	T807M	probably damaging	Het
Lifr	A	G	15: 7,172,972	T365A	probably benign	Het
Lpin1	A	T	12: 16,544,657	S795T	possibly damaging	Het
Magi2	A	C	5: 20,611,069	M1128L	probably benign	Het
Magi3	A	T	3: 104,054,538		probably null	Het
Mier1	T	A	4: 103,159,702	L380*	probably null	Het
Mtmr14	A	G	6: 113,253,789	Y118C	probably damaging	Het
Myof	A	T	19: 37,982,973	M277K	probably damaging	Het
Nsfl1c	T	A	2: 151,505,400	N164K	probably benign	Het
Olfm3	A	T	3: 115,122,538	Q353L	probably benign	Het
Olfr1170	T	C	2: 88,224,547	I162V	probably benign	Het
Olfr131	A	G	17: 38,082,363	V205A	probably benign	Het
Olfr727	A	G	14: 50,126,682	Y35C	probably damaging	Het
Opn5	A	T	17: 42,611,308	M1K	probably null	Het
Pax8	A	G	2: 24,421,622	S434P	probably damaging	Het
Pigo	G	A	4: 43,023,389	Q256*	probably null	Het
Pik3ap1	A	C	19: 41,296,456	F597V	probably damaging	Het
Pkd2	A	G	5: 104,498,558	K744E	probably damaging	Het
Prom1	T	C	5: 44,004,963	T729A	probably benign	Het
Rasal1	T	C	5: 120,675,517	L652P	probably damaging	Het
Sebox	T	C	11: 78,504,191		probably null	Het
Setd2	A	T	9: 110,574,044	I1918F	probably benign	Het
Slc24a2	A	T	4: 87,011,588		probably null	Het
Slc28a1	G	T	7: 81,115,612	G25V	probably benign	Het
Slc51a	A	G	16: 32,477,172	F259L	possibly damaging	Het
Slco2a1	T	A	9: 103,046,699	C37*	probably null	Het
Speer4f2	A	G	5: 17,376,624	D188G	probably damaging	Het
Stim2	A	G	5: 54,102,643	K156E	probably benign	Het
Strn4	T	C	7: 16,838,321	I653T	probably damaging	Het
Tacr3	G	T	3: 134,932,299	D406Y	possibly damaging	Het
Utp20	G	A	10: 88,815,922	R400C	probably benign	Het
V1rd19	C	T	7: 24,003,949	S280L	probably benign	Het
Vmn2r4	C	T	3: 64,389,264	C700Y	probably damaging	Het
Zufsp	A	T	10: 33,927,547	C514S	probably damaging	Het

Other mutations in Nlrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Nlrp6	APN	7	140923124	missense	probably damaging	1.00
IGL01066:Nlrp6	APN	7	140921796	missense	possibly damaging	0.88
IGL01966:Nlrp6	APN	7	140925190	missense	probably damaging	1.00
IGL02625:Nlrp6	APN	7	140923500	missense	probably benign	0.00
IGL02792:Nlrp6	APN	7	140922435	missense	probably damaging	0.97
IGL02813:Nlrp6	APN	7	140923420	missense	possibly damaging	0.86
IGL03140:Nlrp6	APN	7	140927487	missense	probably benign	0.01
R0608:Nlrp6	UTSW	7	140923486	nonsense	probably null
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1472:Nlrp6	UTSW	7	140923495	missense	probably damaging	1.00
R1587:Nlrp6	UTSW	7	140923046	missense	probably damaging	1.00
R1843:Nlrp6	UTSW	7	140923093	missense	probably damaging	1.00
R1959:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R2097:Nlrp6	UTSW	7	140923204	missense	probably damaging	1.00
R2118:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2119:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2120:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2121:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2290:Nlrp6	UTSW	7	140922163	missense	probably damaging	1.00
R3546:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3547:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3970:Nlrp6	UTSW	7	140921655	missense	probably damaging	1.00
R4483:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4484:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4869:Nlrp6	UTSW	7	140924093	missense	probably damaging	1.00
R4962:Nlrp6	UTSW	7	140923584	missense	probably damaging	0.99
R5436:Nlrp6	UTSW	7	140922717	nonsense	probably null
R5442:Nlrp6	UTSW	7	140922190	missense	probably benign	0.01
R5936:Nlrp6	UTSW	7	140922812	nonsense	probably null
R6124:Nlrp6	UTSW	7	140923247	missense	probably damaging	1.00
R6455:Nlrp6	UTSW	7	140927509	missense	possibly damaging	0.65
R6480:Nlrp6	UTSW	7	140927443	missense	possibly damaging	0.93
R6873:Nlrp6	UTSW	7	140923520	missense	probably benign	0.01
R7061:Nlrp6	UTSW	7	140922867	missense	probably benign	0.36
R7350:Nlrp6	UTSW	7	140921278	start gained	probably benign
R7532:Nlrp6	UTSW	7	140925184	missense	probably benign	0.00
R7752:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R7901:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R8098:Nlrp6	UTSW	7	140923255	missense	probably damaging	1.00
R8381:Nlrp6	UTSW	7	140923841	missense	possibly damaging	0.47
R8513:Nlrp6	UTSW	7	140922830	missense	possibly damaging	0.83
R9114:Nlrp6	UTSW	7	140926419	missense	probably damaging	1.00
V7732:Nlrp6	UTSW	7	140926648	splice site	probably benign
Z1176:Nlrp6	UTSW	7	140922721	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCCAAGACCACTACTTCTGTG -3'
(R):5'- GGTGGTCAGTGCAAGATGAC -3'

Sequencing Primer
(F):5'- AAGACCACTACTTCTGTGTACCTG -3'
(R):5'- GTGCAAGATGACCACGTAGCTC -3'

Posted On

2017-02-28