Incidental Mutation 'R5924:Col6a1'
ID461738
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Namecollagen, type VI, alpha 1
SynonymsCol6a-1
MMRRC Submission 044119-MU
Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5924 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76708792-76726168 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 76718371 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
Predicted Effect probably null
Transcript: ENSMUST00000001147
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137599
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,706,085 Y76C probably damaging Het
Agbl1 C T 7: 76,409,234 T204I probably benign Het
Apc2 A T 10: 80,312,150 I984F probably damaging Het
Art3 A T 5: 92,412,232 probably benign Het
B4galnt4 A G 7: 141,070,829 M839V probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cdhr2 A C 13: 54,726,683 D856A probably benign Het
Cep78 A T 19: 15,961,066 L506Q probably damaging Het
Cyp3a44 A T 5: 145,794,327 F221Y possibly damaging Het
Dcakd C A 11: 102,999,820 R47L probably benign Het
Ddr2 A G 1: 169,994,628 V417A probably benign Het
Dnah5 A T 15: 28,307,327 T1734S probably benign Het
Eefsec A T 6: 88,355,547 M227K probably damaging Het
Eif4g3 T G 4: 138,201,926 N1628K probably damaging Het
Epha5 A T 5: 84,233,674 Y439* probably null Het
Esrp1 G T 4: 11,361,174 T324K probably damaging Het
Flnb T A 14: 7,890,765 M549K probably benign Het
Fndc1 T A 17: 7,773,610 Q418L unknown Het
Ggnbp2 A G 11: 84,858,537 S144P possibly damaging Het
Gk5 T C 9: 96,150,510 probably null Het
Gpr137 A G 19: 6,939,361 L228P probably damaging Het
Gpt2 C A 8: 85,493,004 S26R probably damaging Het
Hras C T 7: 141,192,461 E91K possibly damaging Het
Ighv1-36 G A 12: 114,880,157 P28S possibly damaging Het
Kalrn G A 16: 34,243,833 T807M probably damaging Het
Lifr A G 15: 7,172,972 T365A probably benign Het
Lpin1 A T 12: 16,544,657 S795T possibly damaging Het
Magi2 A C 5: 20,611,069 M1128L probably benign Het
Magi3 A T 3: 104,054,538 probably null Het
Mier1 T A 4: 103,159,702 L380* probably null Het
Mtmr14 A G 6: 113,253,789 Y118C probably damaging Het
Myof A T 19: 37,982,973 M277K probably damaging Het
Nlrp6 T C 7: 140,923,490 V473A probably damaging Het
Nsfl1c T A 2: 151,505,400 N164K probably benign Het
Olfm3 A T 3: 115,122,538 Q353L probably benign Het
Olfr1170 T C 2: 88,224,547 I162V probably benign Het
Olfr131 A G 17: 38,082,363 V205A probably benign Het
Olfr727 A G 14: 50,126,682 Y35C probably damaging Het
Opn5 A T 17: 42,611,308 M1K probably null Het
Pax8 A G 2: 24,421,622 S434P probably damaging Het
Pigo G A 4: 43,023,389 Q256* probably null Het
Pik3ap1 A C 19: 41,296,456 F597V probably damaging Het
Pkd2 A G 5: 104,498,558 K744E probably damaging Het
Prom1 T C 5: 44,004,963 T729A probably benign Het
Rasal1 T C 5: 120,675,517 L652P probably damaging Het
Sebox T C 11: 78,504,191 probably null Het
Setd2 A T 9: 110,574,044 I1918F probably benign Het
Slc24a2 A T 4: 87,011,588 probably null Het
Slc28a1 G T 7: 81,115,612 G25V probably benign Het
Slc51a A G 16: 32,477,172 F259L possibly damaging Het
Slco2a1 T A 9: 103,046,699 C37* probably null Het
Speer4f2 A G 5: 17,376,624 D188G probably damaging Het
Stim2 A G 5: 54,102,643 K156E probably benign Het
Strn4 T C 7: 16,838,321 I653T probably damaging Het
Tacr3 G T 3: 134,932,299 D406Y possibly damaging Het
Utp20 G A 10: 88,815,922 R400C probably benign Het
V1rd19 C T 7: 24,003,949 S280L probably benign Het
Vmn2r4 C T 3: 64,389,264 C700Y probably damaging Het
Zufsp A T 10: 33,927,547 C514S probably damaging Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76710979 missense unknown
IGL01943:Col6a1 APN 10 76719123 critical splice donor site probably null
IGL02178:Col6a1 APN 10 76711075 missense unknown
IGL02928:Col6a1 APN 10 76709666 missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76718051 splice site probably benign
P0005:Col6a1 UTSW 10 76717329 splice site probably benign
R0398:Col6a1 UTSW 10 76710118 missense unknown
R0631:Col6a1 UTSW 10 76709735 missense probably benign 0.03
R0698:Col6a1 UTSW 10 76716280 missense unknown
R0699:Col6a1 UTSW 10 76716280 missense unknown
R0848:Col6a1 UTSW 10 76713624 critical splice donor site probably null
R1053:Col6a1 UTSW 10 76720966 missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76712324 missense unknown
R1480:Col6a1 UTSW 10 76709918 missense unknown
R1854:Col6a1 UTSW 10 76721949 missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76721956 missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76709596 missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76721498 missense probably benign 0.10
R2411:Col6a1 UTSW 10 76711088 missense unknown
R3236:Col6a1 UTSW 10 76711320 missense unknown
R3417:Col6a1 UTSW 10 76712369 missense unknown
R3832:Col6a1 UTSW 10 76711117 missense unknown
R3843:Col6a1 UTSW 10 76711341 missense unknown
R3903:Col6a1 UTSW 10 76711341 missense unknown
R3904:Col6a1 UTSW 10 76711341 missense unknown
R4409:Col6a1 UTSW 10 76721500 missense probably benign 0.17
R4418:Col6a1 UTSW 10 76718405 nonsense probably null
R4568:Col6a1 UTSW 10 76719197 intron probably benign
R4579:Col6a1 UTSW 10 76711357 missense unknown
R4661:Col6a1 UTSW 10 76714672 missense unknown
R4945:Col6a1 UTSW 10 76712272 missense unknown
R4958:Col6a1 UTSW 10 76723505 missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76709906 missense unknown
R5440:Col6a1 UTSW 10 76723454 missense probably damaging 1.00
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6366:Col6a1 UTSW 10 76710970 missense unknown
R6435:Col6a1 UTSW 10 76711123 missense unknown
R6718:Col6a1 UTSW 10 76725050 missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76721443 missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76725009 missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76710341 splice site probably null
R7183:Col6a1 UTSW 10 76716259 critical splice donor site probably null
R7244:Col6a1 UTSW 10 76717408 nonsense probably null
R7625:Col6a1 UTSW 10 76713926 missense unknown
R7741:Col6a1 UTSW 10 76709909 missense unknown
R7774:Col6a1 UTSW 10 76709876 missense unknown
R7834:Col6a1 UTSW 10 76709928 missense unknown
R8145:Col6a1 UTSW 10 76723471 missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76725029 missense probably damaging 1.00
RF019:Col6a1 UTSW 10 76711615 missense unknown
X0010:Col6a1 UTSW 10 76723538 missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76709975 missense unknown
Z1088:Col6a1 UTSW 10 76709559 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGAGGCTAGAGTTCTGTTCATC -3'
(R):5'- TTTCCACAGGGTTCCAGAGG -3'

Sequencing Primer
(F):5'- AGGCTAGAGTTCTGTTCATCCAACC -3'
(R):5'- CAGGGTTCCAGAGGACCGAAAG -3'
Posted On2017-02-28