Incidental Mutation 'R5924:Lpin1'
ID461743
Institutional Source Beutler Lab
Gene Symbol Lpin1
Ensembl Gene ENSMUSG00000020593
Gene Namelipin 1
SynonymsLipin1
MMRRC Submission 044119-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R5924 (G1)
Quality Score205
Status Not validated
Chromosome12
Chromosomal Location16535669-16610966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16544657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 795 (S795T)
Ref Sequence ENSEMBL: ENSMUSP00000152285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067124
AA Change: S795T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593
AA Change: S795T

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 1.1e-48 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:Lipin_mid 498 591 9.4e-36 PFAM
low complexity region 630 642 N/A INTRINSIC
LNS2 708 864 3.42e-100 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111067
AA Change: S795T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593
AA Change: S795T

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
LNS2 675 831 3.42e-100 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000221230
AA Change: S762T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221297
AA Change: S795T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222989
AA Change: S762T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,706,085 Y76C probably damaging Het
Agbl1 C T 7: 76,409,234 T204I probably benign Het
Apc2 A T 10: 80,312,150 I984F probably damaging Het
Art3 A T 5: 92,412,232 probably benign Het
B4galnt4 A G 7: 141,070,829 M839V probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cdhr2 A C 13: 54,726,683 D856A probably benign Het
Cep78 A T 19: 15,961,066 L506Q probably damaging Het
Col6a1 A G 10: 76,718,371 probably null Het
Cyp3a44 A T 5: 145,794,327 F221Y possibly damaging Het
Dcakd C A 11: 102,999,820 R47L probably benign Het
Ddr2 A G 1: 169,994,628 V417A probably benign Het
Dnah5 A T 15: 28,307,327 T1734S probably benign Het
Eefsec A T 6: 88,355,547 M227K probably damaging Het
Eif4g3 T G 4: 138,201,926 N1628K probably damaging Het
Epha5 A T 5: 84,233,674 Y439* probably null Het
Esrp1 G T 4: 11,361,174 T324K probably damaging Het
Flnb T A 14: 7,890,765 M549K probably benign Het
Fndc1 T A 17: 7,773,610 Q418L unknown Het
Ggnbp2 A G 11: 84,858,537 S144P possibly damaging Het
Gk5 T C 9: 96,150,510 probably null Het
Gpr137 A G 19: 6,939,361 L228P probably damaging Het
Gpt2 C A 8: 85,493,004 S26R probably damaging Het
Hras C T 7: 141,192,461 E91K possibly damaging Het
Ighv1-36 G A 12: 114,880,157 P28S possibly damaging Het
Kalrn G A 16: 34,243,833 T807M probably damaging Het
Lifr A G 15: 7,172,972 T365A probably benign Het
Magi2 A C 5: 20,611,069 M1128L probably benign Het
Magi3 A T 3: 104,054,538 probably null Het
Mier1 T A 4: 103,159,702 L380* probably null Het
Mtmr14 A G 6: 113,253,789 Y118C probably damaging Het
Myof A T 19: 37,982,973 M277K probably damaging Het
Nlrp6 T C 7: 140,923,490 V473A probably damaging Het
Nsfl1c T A 2: 151,505,400 N164K probably benign Het
Olfm3 A T 3: 115,122,538 Q353L probably benign Het
Olfr1170 T C 2: 88,224,547 I162V probably benign Het
Olfr131 A G 17: 38,082,363 V205A probably benign Het
Olfr727 A G 14: 50,126,682 Y35C probably damaging Het
Opn5 A T 17: 42,611,308 M1K probably null Het
Pax8 A G 2: 24,421,622 S434P probably damaging Het
Pigo G A 4: 43,023,389 Q256* probably null Het
Pik3ap1 A C 19: 41,296,456 F597V probably damaging Het
Pkd2 A G 5: 104,498,558 K744E probably damaging Het
Prom1 T C 5: 44,004,963 T729A probably benign Het
Rasal1 T C 5: 120,675,517 L652P probably damaging Het
Sebox T C 11: 78,504,191 probably null Het
Setd2 A T 9: 110,574,044 I1918F probably benign Het
Slc24a2 A T 4: 87,011,588 probably null Het
Slc28a1 G T 7: 81,115,612 G25V probably benign Het
Slc51a A G 16: 32,477,172 F259L possibly damaging Het
Slco2a1 T A 9: 103,046,699 C37* probably null Het
Speer4f2 A G 5: 17,376,624 D188G probably damaging Het
Stim2 A G 5: 54,102,643 K156E probably benign Het
Strn4 T C 7: 16,838,321 I653T probably damaging Het
Tacr3 G T 3: 134,932,299 D406Y possibly damaging Het
Utp20 G A 10: 88,815,922 R400C probably benign Het
V1rd19 C T 7: 24,003,949 S280L probably benign Het
Vmn2r4 C T 3: 64,389,264 C700Y probably damaging Het
Zufsp A T 10: 33,927,547 C514S probably damaging Het
Other mutations in Lpin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Lpin1 APN 12 16553992 missense probably benign 0.00
IGL00929:Lpin1 APN 12 16573699 missense probably benign 0.05
IGL01485:Lpin1 APN 12 16562357 splice site probably benign
IGL01750:Lpin1 APN 12 16577176 missense probably benign 0.00
IGL01774:Lpin1 APN 12 16558476 missense probably damaging 0.96
IGL02197:Lpin1 APN 12 16558407 critical splice donor site probably null
IGL02244:Lpin1 APN 12 16541769 missense probably damaging 0.99
IGL02272:Lpin1 APN 12 16547600 missense probably damaging 1.00
IGL03366:Lpin1 APN 12 16544677 missense probably damaging 1.00
lipin UTSW 12 16547499 missense probably damaging 1.00
R0044:Lpin1 UTSW 12 16568529 splice site probably benign
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0676:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R1119:Lpin1 UTSW 12 16563721 missense probably damaging 1.00
R1570:Lpin1 UTSW 12 16560998 missense possibly damaging 0.94
R1611:Lpin1 UTSW 12 16577218 missense probably null 0.64
R1646:Lpin1 UTSW 12 16573658 critical splice donor site probably null
R1756:Lpin1 UTSW 12 16538540 missense probably damaging 0.99
R1870:Lpin1 UTSW 12 16541743 missense probably damaging 1.00
R1912:Lpin1 UTSW 12 16546727 missense probably damaging 0.96
R1971:Lpin1 UTSW 12 16580723 missense probably damaging 1.00
R2484:Lpin1 UTSW 12 16547499 missense probably damaging 1.00
R2901:Lpin1 UTSW 12 16553998 missense probably benign
R3195:Lpin1 UTSW 12 16565583 missense possibly damaging 0.91
R3779:Lpin1 UTSW 12 16564568 missense probably damaging 0.96
R3918:Lpin1 UTSW 12 16571189 missense probably benign 0.00
R4532:Lpin1 UTSW 12 16553962 missense probably benign 0.01
R4857:Lpin1 UTSW 12 16563630 missense possibly damaging 0.86
R4882:Lpin1 UTSW 12 16538536 missense probably damaging 1.00
R5024:Lpin1 UTSW 12 16554006 missense probably benign 0.38
R5084:Lpin1 UTSW 12 16576982 missense probably damaging 1.00
R5108:Lpin1 UTSW 12 16573715 missense probably benign 0.39
R5191:Lpin1 UTSW 12 16580828 missense possibly damaging 0.95
R5377:Lpin1 UTSW 12 16563655 missense probably damaging 1.00
R5587:Lpin1 UTSW 12 16573714 missense probably damaging 1.00
R5659:Lpin1 UTSW 12 16540989 missense probably damaging 1.00
R6391:Lpin1 UTSW 12 16564553 missense probably benign 0.29
R6746:Lpin1 UTSW 12 16565528 missense probably benign
R6799:Lpin1 UTSW 12 16561044 missense probably damaging 1.00
R6969:Lpin1 UTSW 12 16580861 missense probably damaging 0.99
R7557:Lpin1 UTSW 12 16580792 missense
Predicted Primers PCR Primer
(F):5'- ATACACACATGGCTTCTAGGGC -3'
(R):5'- TTCACATGTGGGCCACTTGC -3'

Sequencing Primer
(F):5'- ACACATGGCTTCTAGGGCTCAAG -3'
(R):5'- ATGCCACTCTTCATAGGGCTGAG -3'
Posted On2017-02-28