Incidental Mutation 'R5924:Flnb'
ID 461746
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 044119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5924 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7890765 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 549 (M549K)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: M549K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: M549K

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228206
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,706,085 (GRCm39) Y76C probably damaging Het
Agbl1 C T 7: 76,058,982 (GRCm39) T204I probably benign Het
Apc2 A T 10: 80,147,984 (GRCm39) I984F probably damaging Het
Art3 A T 5: 92,560,091 (GRCm39) probably benign Het
B4galnt4 A G 7: 140,650,742 (GRCm39) M839V probably damaging Het
Bnip2 A G 9: 69,904,444 (GRCm39) D67G probably benign Het
Cdhr2 A C 13: 54,874,496 (GRCm39) D856A probably benign Het
Cep78 A T 19: 15,938,430 (GRCm39) L506Q probably damaging Het
Col6a1 A G 10: 76,554,205 (GRCm39) probably null Het
Cyp3a44 A T 5: 145,731,137 (GRCm39) F221Y possibly damaging Het
Dcakd C A 11: 102,890,646 (GRCm39) R47L probably benign Het
Ddr2 A G 1: 169,822,197 (GRCm39) V417A probably benign Het
Dnah5 A T 15: 28,307,473 (GRCm39) T1734S probably benign Het
Eefsec A T 6: 88,332,529 (GRCm39) M227K probably damaging Het
Eif4g3 T G 4: 137,929,237 (GRCm39) N1628K probably damaging Het
Epha5 A T 5: 84,381,533 (GRCm39) Y439* probably null Het
Esrp1 G T 4: 11,361,174 (GRCm39) T324K probably damaging Het
Fndc1 T A 17: 7,992,442 (GRCm39) Q418L unknown Het
Ggnbp2 A G 11: 84,749,363 (GRCm39) S144P possibly damaging Het
Gk5 T C 9: 96,032,563 (GRCm39) probably null Het
Gpr137 A G 19: 6,916,729 (GRCm39) L228P probably damaging Het
Gpt2 C A 8: 86,219,633 (GRCm39) S26R probably damaging Het
Hras C T 7: 140,772,374 (GRCm39) E91K possibly damaging Het
Ighv1-36 G A 12: 114,843,777 (GRCm39) P28S possibly damaging Het
Kalrn G A 16: 34,064,203 (GRCm39) T807M probably damaging Het
Lifr A G 15: 7,202,453 (GRCm39) T365A probably benign Het
Lpin1 A T 12: 16,594,658 (GRCm39) S795T possibly damaging Het
Magi2 A C 5: 20,816,067 (GRCm39) M1128L probably benign Het
Magi3 A T 3: 103,961,854 (GRCm39) probably null Het
Mier1 T A 4: 103,016,899 (GRCm39) L380* probably null Het
Mtmr14 A G 6: 113,230,750 (GRCm39) Y118C probably damaging Het
Myof A T 19: 37,971,421 (GRCm39) M277K probably damaging Het
Nlrp6 T C 7: 140,503,403 (GRCm39) V473A probably damaging Het
Nsfl1c T A 2: 151,347,320 (GRCm39) N164K probably benign Het
Olfm3 A T 3: 114,916,187 (GRCm39) Q353L probably benign Het
Opn5 A T 17: 42,922,199 (GRCm39) M1K probably null Het
Or2y3 A G 17: 38,393,254 (GRCm39) V205A probably benign Het
Or4k15 A G 14: 50,364,139 (GRCm39) Y35C probably damaging Het
Or5d41 T C 2: 88,054,891 (GRCm39) I162V probably benign Het
Pax8 A G 2: 24,311,634 (GRCm39) S434P probably damaging Het
Pigo G A 4: 43,023,389 (GRCm39) Q256* probably null Het
Pik3ap1 A C 19: 41,284,895 (GRCm39) F597V probably damaging Het
Pkd2 A G 5: 104,646,424 (GRCm39) K744E probably damaging Het
Prom1 T C 5: 44,162,305 (GRCm39) T729A probably benign Het
Rasal1 T C 5: 120,813,582 (GRCm39) L652P probably damaging Het
Sebox T C 11: 78,395,017 (GRCm39) probably null Het
Setd2 A T 9: 110,403,112 (GRCm39) I1918F probably benign Het
Slc24a2 A T 4: 86,929,825 (GRCm39) probably null Het
Slc28a1 G T 7: 80,765,360 (GRCm39) G25V probably benign Het
Slc51a A G 16: 32,295,990 (GRCm39) F259L possibly damaging Het
Slco2a1 T A 9: 102,923,898 (GRCm39) C37* probably null Het
Speer4f2 A G 5: 17,581,622 (GRCm39) D188G probably damaging Het
Stim2 A G 5: 54,259,985 (GRCm39) K156E probably benign Het
Strn4 T C 7: 16,572,246 (GRCm39) I653T probably damaging Het
Tacr3 G T 3: 134,638,060 (GRCm39) D406Y possibly damaging Het
Utp20 G A 10: 88,651,784 (GRCm39) R400C probably benign Het
V1rd19 C T 7: 23,703,374 (GRCm39) S280L probably benign Het
Vmn2r4 C T 3: 64,296,685 (GRCm39) C700Y probably damaging Het
Zup1 A T 10: 33,803,543 (GRCm39) C514S probably damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0128:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCAAACCAGAGCAAGTGTGTTG -3'
(R):5'- ATGTGAGGCTCGAACACTAG -3'

Sequencing Primer
(F):5'- TTGACATAACAATGGCTGTGGG -3'
(R):5'- ACTAGGCACCTCGTTACTCAG -3'
Posted On 2017-02-28