Incidental Mutation 'R0566:Perm1'
ID46176
Institutional Source Beutler Lab
Gene Symbol Perm1
Ensembl Gene ENSMUSG00000078486
Gene NamePPARGC1 and ESRR induced regulator, muscle 1
Synonyms2310042D19Rik
MMRRC Submission 038757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0566 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location156215868-156221307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156217859 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 287 (M287L)
Ref Sequence ENSEMBL: ENSMUSP00000101197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
AA Change: M287L

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486
AA Change: M287L

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 122,781,527 L254P possibly damaging Het
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Gnpda2 A G 5: 69,584,961 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Olfr456 T A 6: 42,487,091 Y34F probably damaging Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Piwil2 A G 14: 70,410,394 V323A probably damaging Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Prr23a2 T A 9: 98,856,988 L133H possibly damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Tnrc6a A T 7: 123,170,913 N642I probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Perm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL01970:Perm1 APN 4 156217661 missense probably damaging 0.99
IGL02143:Perm1 APN 4 156218043 missense probably benign 0.09
IGL02644:Perm1 APN 4 156218586 missense probably damaging 1.00
IGL02993:Perm1 APN 4 156217779 missense probably benign 0.20
PIT4366001:Perm1 UTSW 4 156218735 missense probably benign 0.11
R0052:Perm1 UTSW 4 156218115 missense probably damaging 1.00
R0105:Perm1 UTSW 4 156218225 missense probably benign 0.23
R1184:Perm1 UTSW 4 156217314 missense probably damaging 1.00
R1208:Perm1 UTSW 4 156217002 start codon destroyed probably null 0.92
R1244:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1724:Perm1 UTSW 4 156218072 missense possibly damaging 0.82
R1783:Perm1 UTSW 4 156218531 nonsense probably null
R1817:Perm1 UTSW 4 156218604 missense possibly damaging 0.59
R1892:Perm1 UTSW 4 156217883 missense probably benign 0.09
R1893:Perm1 UTSW 4 156217883 missense probably benign 0.09
R2106:Perm1 UTSW 4 156218879 missense probably damaging 1.00
R2567:Perm1 UTSW 4 156217118 missense probably damaging 0.99
R3752:Perm1 UTSW 4 156217946 missense probably benign 0.01
R3934:Perm1 UTSW 4 156219170 missense probably benign
R4509:Perm1 UTSW 4 156217586 missense probably benign 0.02
R4667:Perm1 UTSW 4 156220206 nonsense probably null
R4706:Perm1 UTSW 4 156217074 missense probably damaging 0.99
R4812:Perm1 UTSW 4 156218736 missense possibly damaging 0.59
R4979:Perm1 UTSW 4 156217577 missense probably benign 0.01
R5275:Perm1 UTSW 4 156217518 missense probably benign
R5295:Perm1 UTSW 4 156217518 missense probably benign
R5425:Perm1 UTSW 4 156218295 missense probably benign 0.04
R6125:Perm1 UTSW 4 156217719 missense probably benign 0.00
R6573:Perm1 UTSW 4 156218673 missense probably damaging 1.00
R6721:Perm1 UTSW 4 156218319 missense probably benign 0.00
R6986:Perm1 UTSW 4 156218519 nonsense probably null
R7190:Perm1 UTSW 4 156219815 missense possibly damaging 0.84
R7561:Perm1 UTSW 4 156218760 missense probably benign
R7578:Perm1 UTSW 4 156218068 unclassified probably benign
R7769:Perm1 UTSW 4 156218068 unclassified probably benign
R7876:Perm1 UTSW 4 156217589 missense probably damaging 0.98
R7899:Perm1 UTSW 4 156218068 unclassified probably benign
R7934:Perm1 UTSW 4 156218068 unclassified probably benign
R7959:Perm1 UTSW 4 156217589 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGATGGCAAAAGCCCAGCAG -3'
(R):5'- GTGTAGACAAAGCCATGTCAGGCTC -3'

Sequencing Primer
(F):5'- GGATAAGCCACAGCCTGACTC -3'
(R):5'- CCATGTCAGGCTCAGAGG -3'
Posted On2013-06-11