Incidental Mutation 'R5924:Cep78'
ID461760
Institutional Source Beutler Lab
Gene Symbol Cep78
Ensembl Gene ENSMUSG00000041491
Gene Namecentrosomal protein 78
Synonyms5730599I05Rik
MMRRC Submission 044119-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R5924 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location15955774-15984989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15961066 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 506 (L506Q)
Ref Sequence ENSEMBL: ENSMUSP00000037596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047704]
Predicted Effect probably damaging
Transcript: ENSMUST00000047704
AA Change: L506Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037596
Gene: ENSMUSG00000041491
AA Change: L506Q

DomainStartEndE-ValueType
LRR 152 179 2.95e-3 SMART
Blast:LRR 180 207 1e-10 BLAST
LRR 231 259 6.28e-1 SMART
LRR 260 287 8.81e-2 SMART
LRR 288 313 1.96e2 SMART
low complexity region 427 450 N/A INTRINSIC
coiled coil region 462 511 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 T C 18: 10,706,085 Y76C probably damaging Het
Agbl1 C T 7: 76,409,234 T204I probably benign Het
Apc2 A T 10: 80,312,150 I984F probably damaging Het
Art3 A T 5: 92,412,232 probably benign Het
B4galnt4 A G 7: 141,070,829 M839V probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cdhr2 A C 13: 54,726,683 D856A probably benign Het
Col6a1 A G 10: 76,718,371 probably null Het
Cyp3a44 A T 5: 145,794,327 F221Y possibly damaging Het
Dcakd C A 11: 102,999,820 R47L probably benign Het
Ddr2 A G 1: 169,994,628 V417A probably benign Het
Dnah5 A T 15: 28,307,327 T1734S probably benign Het
Eefsec A T 6: 88,355,547 M227K probably damaging Het
Eif4g3 T G 4: 138,201,926 N1628K probably damaging Het
Epha5 A T 5: 84,233,674 Y439* probably null Het
Esrp1 G T 4: 11,361,174 T324K probably damaging Het
Flnb T A 14: 7,890,765 M549K probably benign Het
Fndc1 T A 17: 7,773,610 Q418L unknown Het
Ggnbp2 A G 11: 84,858,537 S144P possibly damaging Het
Gk5 T C 9: 96,150,510 probably null Het
Gpr137 A G 19: 6,939,361 L228P probably damaging Het
Gpt2 C A 8: 85,493,004 S26R probably damaging Het
Hras C T 7: 141,192,461 E91K possibly damaging Het
Ighv1-36 G A 12: 114,880,157 P28S possibly damaging Het
Kalrn G A 16: 34,243,833 T807M probably damaging Het
Lifr A G 15: 7,172,972 T365A probably benign Het
Lpin1 A T 12: 16,544,657 S795T possibly damaging Het
Magi2 A C 5: 20,611,069 M1128L probably benign Het
Magi3 A T 3: 104,054,538 probably null Het
Mier1 T A 4: 103,159,702 L380* probably null Het
Mtmr14 A G 6: 113,253,789 Y118C probably damaging Het
Myof A T 19: 37,982,973 M277K probably damaging Het
Nlrp6 T C 7: 140,923,490 V473A probably damaging Het
Nsfl1c T A 2: 151,505,400 N164K probably benign Het
Olfm3 A T 3: 115,122,538 Q353L probably benign Het
Olfr1170 T C 2: 88,224,547 I162V probably benign Het
Olfr131 A G 17: 38,082,363 V205A probably benign Het
Olfr727 A G 14: 50,126,682 Y35C probably damaging Het
Opn5 A T 17: 42,611,308 M1K probably null Het
Pax8 A G 2: 24,421,622 S434P probably damaging Het
Pigo G A 4: 43,023,389 Q256* probably null Het
Pik3ap1 A C 19: 41,296,456 F597V probably damaging Het
Pkd2 A G 5: 104,498,558 K744E probably damaging Het
Prom1 T C 5: 44,004,963 T729A probably benign Het
Rasal1 T C 5: 120,675,517 L652P probably damaging Het
Sebox T C 11: 78,504,191 probably null Het
Setd2 A T 9: 110,574,044 I1918F probably benign Het
Slc24a2 A T 4: 87,011,588 probably null Het
Slc28a1 G T 7: 81,115,612 G25V probably benign Het
Slc51a A G 16: 32,477,172 F259L possibly damaging Het
Slco2a1 T A 9: 103,046,699 C37* probably null Het
Speer4f2 A G 5: 17,376,624 D188G probably damaging Het
Stim2 A G 5: 54,102,643 K156E probably benign Het
Strn4 T C 7: 16,838,321 I653T probably damaging Het
Tacr3 G T 3: 134,932,299 D406Y possibly damaging Het
Utp20 G A 10: 88,815,922 R400C probably benign Het
V1rd19 C T 7: 24,003,949 S280L probably benign Het
Vmn2r4 C T 3: 64,389,264 C700Y probably damaging Het
Zufsp A T 10: 33,927,547 C514S probably damaging Het
Other mutations in Cep78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cep78 APN 19 15969140 missense probably benign
IGL00920:Cep78 APN 19 15981486 missense probably benign 0.03
IGL01548:Cep78 APN 19 15981200 splice site probably benign
IGL01662:Cep78 APN 19 15960995 missense probably damaging 1.00
IGL01933:Cep78 APN 19 15955940 missense probably benign
IGL02014:Cep78 APN 19 15984738 missense probably damaging 1.00
IGL02198:Cep78 APN 19 15956369 missense probably damaging 1.00
IGL02331:Cep78 APN 19 15974415 missense probably benign 0.16
IGL02431:Cep78 APN 19 15959579 missense probably benign
IGL02731:Cep78 APN 19 15956306 missense probably benign 0.02
IGL03268:Cep78 APN 19 15974442 nonsense probably null
IGL03338:Cep78 APN 19 15959623 missense probably damaging 0.97
himalayas UTSW 19 15969128 missense possibly damaging 0.66
R0426:Cep78 UTSW 19 15970970 nonsense probably null
R0619:Cep78 UTSW 19 15978862 missense probably damaging 0.99
R0659:Cep78 UTSW 19 15956190 missense probably damaging 0.97
R1517:Cep78 UTSW 19 15959663 missense probably damaging 1.00
R1758:Cep78 UTSW 19 15959536 missense probably damaging 1.00
R1836:Cep78 UTSW 19 15969169 missense probably damaging 1.00
R1865:Cep78 UTSW 19 15956004 missense probably damaging 1.00
R1920:Cep78 UTSW 19 15974351 splice site probably benign
R2483:Cep78 UTSW 19 15960980 missense probably damaging 1.00
R2958:Cep78 UTSW 19 15978909 missense probably damaging 1.00
R3814:Cep78 UTSW 19 15981802 critical splice acceptor site probably null
R4133:Cep78 UTSW 19 15969155 missense probably damaging 1.00
R4214:Cep78 UTSW 19 15959579 missense probably benign
R5783:Cep78 UTSW 19 15956359 missense probably benign 0.02
R5791:Cep78 UTSW 19 15961072 missense probably benign 0.19
R5910:Cep78 UTSW 19 15969128 missense possibly damaging 0.66
R6148:Cep78 UTSW 19 15981786 nonsense probably null
R6162:Cep78 UTSW 19 15974940 missense probably benign 0.28
R6235:Cep78 UTSW 19 15976486 intron probably null
R6968:Cep78 UTSW 19 15981738 missense probably benign 0.38
R7228:Cep78 UTSW 19 15969197 missense probably benign 0.01
R7913:Cep78 UTSW 19 15970577 missense probably benign
R7994:Cep78 UTSW 19 15970577 missense probably benign
R8059:Cep78 UTSW 19 15981512 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCGGCAAGCTACAATTAAAGC -3'
(R):5'- GTCTCCAGTGAAGATCATTATGTG -3'

Sequencing Primer
(F):5'- GCTACAATTAAAGCCACTGAAGAATG -3'
(R):5'- CCAGTGAAGATCATTATGTGTTATGG -3'
Posted On2017-02-28