Incidental Mutation 'R0566:Gnpda2'
ID46178
Institutional Source Beutler Lab
Gene Symbol Gnpda2
Ensembl Gene ENSMUSG00000029209
Gene Nameglucosamine-6-phosphate deaminase 2
SynonymsGnp2, 4921523I18Rik, 4933412A11Rik
MMRRC Submission 038757-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0566 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location69573108-69592340 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 69584961 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031117] [ENSMUST00000120789] [ENSMUST00000139632] [ENSMUST00000153536] [ENSMUST00000166298] [ENSMUST00000173927]
Predicted Effect probably benign
Transcript: ENSMUST00000031117
SMART Domains Protein: ENSMUSP00000031117
Gene: ENSMUSG00000029209

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 7 237 2.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120789
SMART Domains Protein: ENSMUSP00000112484
Gene: ENSMUSG00000029209

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 12 217 3.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139632
SMART Domains Protein: ENSMUSP00000121014
Gene: ENSMUSG00000029209

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 12 217 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154018
Predicted Effect probably benign
Transcript: ENSMUST00000166298
SMART Domains Protein: ENSMUSP00000128233
Gene: ENSMUSG00000029209

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 12 215 5.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173927
SMART Domains Protein: ENSMUSP00000133490
Gene: ENSMUSG00000029209

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 12 215 5.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 122,781,527 L254P possibly damaging Het
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Olfr456 T A 6: 42,487,091 Y34F probably damaging Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Perm1 A T 4: 156,217,859 M287L probably benign Het
Piwil2 A G 14: 70,410,394 V323A probably damaging Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Prr23a2 T A 9: 98,856,988 L133H possibly damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Tnrc6a A T 7: 123,170,913 N642I probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Gnpda2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3611:Gnpda2 UTSW 5 69577409 missense probably benign
R4549:Gnpda2 UTSW 5 69586529 missense probably benign 0.00
R5538:Gnpda2 UTSW 5 69578051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGCAGGACGATGACCTGAA -3'
(R):5'- GTTGGTGTAGAAATATGAGGTGGCACAT -3'

Sequencing Primer
(F):5'- GCAATGTGTTAACTGTGGCAATC -3'
(R):5'- TCCTATTTAGGACTTCCAAGAAACC -3'
Posted On2013-06-11