Incidental Mutation 'R5925:Exosc10'
ID461782
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 148573362 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 655 (T655K)
Ref Sequence ENSEMBL: ENSMUSP00000075401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect probably benign
Transcript: ENSMUST00000017408
AA Change: T655K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: T655K

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076022
AA Change: T655K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: T655K

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097781
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173892
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,284,238 V1733A probably benign Het
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Afp T A 5: 90,497,288 C188S probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Ehf T C 2: 103,266,993 probably null Het
Eif2b5 C T 16: 20,508,124 H99Y probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Mpzl3 G T 9: 45,062,114 K50N probably damaging Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr123 T C 17: 37,795,591 I49T probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Tpd52l1 T C 10: 31,332,947 H170R probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 splice site probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
R7967:Exosc10 UTSW 4 148564664 missense probably damaging 1.00
R8225:Exosc10 UTSW 4 148565204 missense possibly damaging 0.86
R8477:Exosc10 UTSW 4 148565390 missense possibly damaging 0.71
R8510:Exosc10 UTSW 4 148564189 missense probably damaging 1.00
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTCTTTGGACCCCATGACTG -3'
(R):5'- TGCCCTGTAGAAAGCTCCAC -3'

Sequencing Primer
(F):5'- ACACCTCAACTGATGGTAAGATG -3'
(R):5'- TGTAGAAAGCTCCACACCTCTCTAG -3'
Posted On2017-02-28