Incidental Mutation 'R5925:Afp'
ID461785
Institutional Source Beutler Lab
Gene Symbol Afp
Ensembl Gene ENSMUSG00000054932
Gene Namealpha fetoprotein
Synonymsalpha-foetoprotein
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90490737-90508907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90497288 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 188 (C188S)
Ref Sequence ENSEMBL: ENSMUSP00000041006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042755] [ENSMUST00000200693]
Predicted Effect probably damaging
Transcript: ENSMUST00000042755
AA Change: C188S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041006
Gene: ENSMUSG00000054932
AA Change: C188S

DomainStartEndE-ValueType
ALBUMIN 20 201 5.33e-70 SMART
ALBUMIN 208 393 8.52e-69 SMART
ALBUMIN 400 591 6.39e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200693
SMART Domains Protein: ENSMUSP00000144019
Gene: ENSMUSG00000054932

DomainStartEndE-ValueType
ALBUMIN 20 121 1.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202955
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes alpha-fetoprotein, a major plasma protein produced by the yolk sac and the liver during fetal life. Alpha-fetoprotein expression in adults is often associated with hepatoma or teratoma. However, hereditary persistance of alpha-fetoprotein may also be found in individuals with no obvious pathology. The protein is thought to be the fetal counterpart of serum albumin, and the alpha-fetoprotein and albumin genes are present in tandem in the same transcriptional orientation on chromosome 4. Alpha-fetoprotein is found in monomeric as well as dimeric and trimeric forms, and binds copper, nickel, fatty acids and bilirubin. The level of alpha-fetoprotein in amniotic fluid is used to measure renal loss of protein to screen for spina bifida and anencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for targeted null mutations are sterile due to impairment of the hypothalamic/pituitary system and failure of the estrus cycle resulting in anovulation. Homozygous males are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,284,238 V1733A probably benign Het
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Ehf T C 2: 103,266,993 probably null Het
Eif2b5 C T 16: 20,508,124 H99Y probably benign Het
Exosc10 C A 4: 148,573,362 T655K probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Mpzl3 G T 9: 45,062,114 K50N probably damaging Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr123 T C 17: 37,795,591 I49T probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Tpd52l1 T C 10: 31,332,947 H170R probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in Afp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03261:Afp APN 5 90491751 critical splice donor site probably null
R0018:Afp UTSW 5 90506741 missense probably damaging 1.00
R0387:Afp UTSW 5 90497291 missense probably damaging 1.00
R0529:Afp UTSW 5 90504395 missense probably damaging 1.00
R1401:Afp UTSW 5 90501627 splice site probably benign
R1471:Afp UTSW 5 90503682 missense possibly damaging 0.49
R1666:Afp UTSW 5 90505068 missense probably damaging 0.99
R1800:Afp UTSW 5 90490796 missense probably benign 0.00
R2138:Afp UTSW 5 90499647 missense probably damaging 1.00
R2248:Afp UTSW 5 90501570 missense probably damaging 0.99
R4324:Afp UTSW 5 90507905 missense probably benign 0.00
R4555:Afp UTSW 5 90506687 missense possibly damaging 0.88
R5035:Afp UTSW 5 90507905 missense probably benign 0.00
R5241:Afp UTSW 5 90501614 missense probably benign 0.37
R6220:Afp UTSW 5 90504410 missense possibly damaging 0.78
R6719:Afp UTSW 5 90503703 missense probably benign 0.01
Z1088:Afp UTSW 5 90505015 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TCCAGAGCTTAGTTCAGGGAG -3'
(R):5'- ACTTCGGCCTAAAGTTATACCTTAC -3'

Sequencing Primer
(F):5'- AGGTGGCAGTCCCTTCATCTG -3'
(R):5'- ACAGGAGGCACATTTCTG -3'
Posted On2017-02-28