Incidental Mutation 'R5925:Mpzl3'
ID461790
Institutional Source Beutler Lab
Gene Symbol Mpzl3
Ensembl Gene ENSMUSG00000070305
Gene Namemyelin protein zero-like 3
SynonymsA530065I17Rik, 5430427F17Rik, rc
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45055186-45077436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45062114 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 50 (K50N)
Ref Sequence ENSEMBL: ENSMUSP00000110311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114663] [ENSMUST00000114664]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093856
SMART Domains Protein: ENSMUSP00000091378
Gene: ENSMUSG00000070305

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 38 82 5e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114663
AA Change: K50N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110311
Gene: ENSMUSG00000070305
AA Change: K50N

DomainStartEndE-ValueType
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 230 6e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114664
AA Change: K50N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110312
Gene: ENSMUSG00000070305
AA Change: K50N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 229 3e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187113
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele have a rough coat that becomes brittle and oily with age, and display stunted growth, cyclic and progressive hair loss, hyperplastic epidermis, abnormal hair follicles, myocardial degeneration, and reduced collagen and elastin content in the skin and heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,284,238 V1733A probably benign Het
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Afp T A 5: 90,497,288 C188S probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Ehf T C 2: 103,266,993 probably null Het
Eif2b5 C T 16: 20,508,124 H99Y probably benign Het
Exosc10 C A 4: 148,573,362 T655K probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr123 T C 17: 37,795,591 I49T probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Tpd52l1 T C 10: 31,332,947 H170R probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in Mpzl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02420:Mpzl3 APN 9 45066517 missense possibly damaging 0.95
IGL02969:Mpzl3 APN 9 45068216 missense probably benign 0.00
mausolus UTSW 9 45068252 missense probably damaging 1.00
satrap UTSW 9 45055244 start codon destroyed probably null 0.06
R0069:Mpzl3 UTSW 9 45068252 missense probably damaging 1.00
R0196:Mpzl3 UTSW 9 45062160 missense probably damaging 0.98
R0557:Mpzl3 UTSW 9 45066508 missense probably damaging 1.00
R1511:Mpzl3 UTSW 9 45066529 missense probably damaging 0.99
R4580:Mpzl3 UTSW 9 45068231 missense possibly damaging 0.94
R4775:Mpzl3 UTSW 9 45066432 missense probably damaging 1.00
R4825:Mpzl3 UTSW 9 45068329 missense probably benign 0.00
R4972:Mpzl3 UTSW 9 45062256 intron probably benign
R5189:Mpzl3 UTSW 9 45062110 missense possibly damaging 0.95
R5371:Mpzl3 UTSW 9 45055212 utr 5 prime probably benign
R7191:Mpzl3 UTSW 9 45055244 start codon destroyed probably null 0.06
R7561:Mpzl3 UTSW 9 45055312 missense probably benign
R7570:Mpzl3 UTSW 9 45070687 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCTTTTGGTGAGATCAC -3'
(R):5'- ACAGCAGGTGACTTTACCCC -3'

Sequencing Primer
(F):5'- CTGAAAATGGTGTGAAGCATCTCTC -3'
(R):5'- AGGAATGGCCTCGATTTCC -3'
Posted On2017-02-28