Incidental Mutation 'R5925:2610507B11Rik'
ID461799
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78284238 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1733 (V1733A)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect probably benign
Transcript: ENSMUST00000010421
AA Change: V1733A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: V1733A

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147432
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Afp T A 5: 90,497,288 C188S probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Ehf T C 2: 103,266,993 probably null Het
Eif2b5 C T 16: 20,508,124 H99Y probably benign Het
Exosc10 C A 4: 148,573,362 T655K probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Mpzl3 G T 9: 45,062,114 K50N probably damaging Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr123 T C 17: 37,795,591 I49T probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Tpd52l1 T C 10: 31,332,947 H170R probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1500:2610507B11Rik UTSW 11 78284132 missense possibly damaging 0.46
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R1987:2610507B11Rik UTSW 11 78268167 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3944:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4196:2610507B11Rik UTSW 11 78263556 intron probably benign
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5719:2610507B11Rik UTSW 11 78273245 missense probably damaging 0.97
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5976:2610507B11Rik UTSW 11 78284129 missense probably benign 0.00
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
R7283:2610507B11Rik UTSW 11 78274828 missense probably damaging 1.00
R7287:2610507B11Rik UTSW 11 78272883 missense possibly damaging 0.61
R7339:2610507B11Rik UTSW 11 78272384 critical splice donor site probably null
R7409:2610507B11Rik UTSW 11 78268757 missense probably damaging 1.00
R7473:2610507B11Rik UTSW 11 78267115 missense possibly damaging 0.86
R7704:2610507B11Rik UTSW 11 78268744 missense probably benign 0.29
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATTCAGATGGGACCTCTTATCACAG -3'
(R):5'- CAGTTTCCTCTAAGAGCACAGG -3'

Sequencing Primer
(F):5'- GACCTCTTATCACAGCTTTTATGGAG -3'
(R):5'- ACAGGCTGTTCTAATGGCC -3'
Posted On2017-02-28