Incidental Mutation 'R5925:Eif2b5'
ID461809
Institutional Source Beutler Lab
Gene Symbol Eif2b5
Ensembl Gene ENSMUSG00000003235
Gene Nameeukaryotic translation initiation factor 2B, subunit 5 epsilon
Synonyms
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20498817-20509323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20508124 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 99 (H99Y)
Ref Sequence ENSEMBL: ENSMUSP00000121169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003320] [ENSMUST00000148714]
Predicted Effect probably benign
Transcript: ENSMUST00000003320
AA Change: H652Y

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000003320
Gene: ENSMUSG00000003235
AA Change: H652Y

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
Pfam:Hexapep 341 372 9.8e-5 PFAM
Pfam:Hexapep 361 389 6.1e-6 PFAM
low complexity region 517 526 N/A INTRINSIC
eIF5C 625 712 8.43e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134992
Predicted Effect probably benign
Transcript: ENSMUST00000148714
AA Change: H99Y

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121169
Gene: ENSMUSG00000003235
AA Change: H99Y

DomainStartEndE-ValueType
Pfam:W2 82 150 7e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000231315
AA Change: H237Y
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of five subunits of eukaryotic translation initiation factor 2B (EIF2B), a GTP exchange factor for eukaryotic initiation factor 2 and an essential regulator for protein synthesis. Mutations in this gene and the genes encoding other EIF2B subunits have been associated with leukoencephalopathy with vanishing white matter. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal brain white matter development, decreased body fat, demyelination, impaired recovery from cuprizone-induced demyelination, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,284,238 V1733A probably benign Het
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Afp T A 5: 90,497,288 C188S probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Ehf T C 2: 103,266,993 probably null Het
Exosc10 C A 4: 148,573,362 T655K probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Mpzl3 G T 9: 45,062,114 K50N probably damaging Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr123 T C 17: 37,795,591 I49T probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Tpd52l1 T C 10: 31,332,947 H170R probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in Eif2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Eif2b5 APN 16 20505252 missense probably benign 0.19
IGL01073:Eif2b5 APN 16 20500296 nonsense probably null
IGL01467:Eif2b5 APN 16 20508964 nonsense probably null
IGL02754:Eif2b5 APN 16 20502786 missense possibly damaging 0.50
IGL03286:Eif2b5 APN 16 20502262 missense probably damaging 1.00
R0569:Eif2b5 UTSW 16 20502553 missense probably benign 0.13
R1321:Eif2b5 UTSW 16 20504689 nonsense probably null
R1647:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1648:Eif2b5 UTSW 16 20502585 missense possibly damaging 0.77
R1897:Eif2b5 UTSW 16 20507037 missense probably damaging 0.99
R2231:Eif2b5 UTSW 16 20504770 missense probably benign
R3196:Eif2b5 UTSW 16 20505522 missense probably benign
R4423:Eif2b5 UTSW 16 20501719 missense probably benign 0.10
R4776:Eif2b5 UTSW 16 20500233 missense probably damaging 1.00
R5240:Eif2b5 UTSW 16 20501398 missense possibly damaging 0.49
R5828:Eif2b5 UTSW 16 20502786 missense possibly damaging 0.50
R5920:Eif2b5 UTSW 16 20498944 missense unknown
R6717:Eif2b5 UTSW 16 20505283 missense probably damaging 0.96
R6915:Eif2b5 UTSW 16 20502750 missense possibly damaging 0.83
R7396:Eif2b5 UTSW 16 20506137 missense possibly damaging 0.69
R8046:Eif2b5 UTSW 16 20506404 missense possibly damaging 0.88
R8196:Eif2b5 UTSW 16 20502556 missense probably damaging 0.99
R8503:Eif2b5 UTSW 16 20498980 missense probably benign 0.23
R8532:Eif2b5 UTSW 16 20505206 missense probably damaging 0.99
Z1187:Eif2b5 UTSW 16 20498921 missense unknown
Z1192:Eif2b5 UTSW 16 20498921 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCCGTCACTGTTGATTGC -3'
(R):5'- ATGGCTGCCTCACTAGCATC -3'

Sequencing Primer
(F):5'- CGTCACTGTTGATTGCCTTTG -3'
(R):5'- TGCACTGCATTACTCCAGCAG -3'
Posted On2017-02-28