Incidental Mutation 'R5925:Olfr123'
ID461810
Institutional Source Beutler Lab
Gene Symbol Olfr123
Ensembl Gene ENSMUSG00000045202
Gene Nameolfactory receptor 123
SynonymsMOR256-9, GA_x6K02T2PSCP-2255106-2256035
MMRRC Submission 044120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R5925 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37793529-37798134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37795591 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 49 (I49T)
Ref Sequence ENSEMBL: ENSMUSP00000149802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054748] [ENSMUST00000214770] [ENSMUST00000215168] [ENSMUST00000216051] [ENSMUST00000216478]
Predicted Effect probably benign
Transcript: ENSMUST00000054748
AA Change: I49T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058678
Gene: ENSMUSG00000045202
AA Change: I49T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 163 2.9e-6 PFAM
Pfam:7tm_4 29 306 2.3e-44 PFAM
Pfam:7TM_GPCR_Srsx 33 144 2.4e-5 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174446
Predicted Effect probably benign
Transcript: ENSMUST00000214770
AA Change: I49T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000215168
Predicted Effect probably benign
Transcript: ENSMUST00000216051
AA Change: I49T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216478
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,284,238 V1733A probably benign Het
9130230L23Rik C T 5: 65,990,392 W16* probably null Het
Abca8a T C 11: 110,057,223 D985G probably damaging Het
Afp T A 5: 90,497,288 C188S probably damaging Het
Ank2 A C 3: 126,932,963 L894R probably benign Het
Antxr1 A G 6: 87,312,362 I60T probably damaging Het
Ccdc187 A G 2: 26,293,581 S136P probably benign Het
Cep95 T C 11: 106,812,401 S393P probably benign Het
Cyfip2 T C 11: 46,207,436 Y1053C probably damaging Het
Diaph1 A G 18: 37,891,935 V491A unknown Het
Ehf T C 2: 103,266,993 probably null Het
Eif2b5 C T 16: 20,508,124 H99Y probably benign Het
Exosc10 C A 4: 148,573,362 T655K probably benign Het
Flg A T 3: 93,279,399 I53F probably damaging Het
Hc T A 2: 35,030,450 D628V possibly damaging Het
Lmo4 A T 3: 144,194,491 N83K probably benign Het
Lrp4 A T 2: 91,511,684 T1881S probably benign Het
Malt1 T A 18: 65,431,368 L66Q possibly damaging Het
Map3k3 T C 11: 106,149,550 S314P probably benign Het
Mpzl3 G T 9: 45,062,114 K50N probably damaging Het
Nbeal2 G T 9: 110,629,880 Q1992K probably benign Het
Nlrp14 T A 7: 107,186,653 N645K probably benign Het
Olfr813 A G 10: 129,856,875 D119G probably damaging Het
Pcdha1 T A 18: 36,930,671 D129E probably damaging Het
Prb1 A G 6: 132,210,512 L2P unknown Het
Rhbdf1 A G 11: 32,212,906 Y454H probably benign Het
Satb2 C T 1: 56,796,938 A565T possibly damaging Het
Sh3pxd2a A T 19: 47,267,612 L889Q probably damaging Het
Sis T C 3: 72,921,380 probably null Het
Slc35e2 T C 4: 155,611,627 V157A probably damaging Het
Slc35f3 T C 8: 126,389,207 V291A probably benign Het
Snph T C 2: 151,594,231 D190G probably damaging Het
Tpd52l1 T C 10: 31,332,947 H170R probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Trip12 G A 1: 84,749,253 Q9* probably null Het
Ttn C T 2: 76,802,248 C12408Y probably damaging Het
Ttn T C 2: 76,809,011 D13806G probably damaging Het
Unc79 G C 12: 103,125,730 probably null Het
Vmn2r81 T C 10: 79,247,803 S4P probably damaging Het
Wdr60 A T 12: 116,233,394 F448I possibly damaging Het
Zfp37 G A 4: 62,191,213 T576I possibly damaging Het
Zfp39 A T 11: 58,891,273 L221Q possibly damaging Het
Zgrf1 A G 3: 127,573,204 H744R possibly damaging Het
Other mutations in Olfr123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Olfr123 APN 17 37795522 missense probably damaging 0.99
IGL03030:Olfr123 APN 17 37796271 missense probably damaging 1.00
IGL03107:Olfr123 APN 17 37795788 missense probably benign 0.01
R0329:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0330:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0524:Olfr123 UTSW 17 37795605 nonsense probably null
R0581:Olfr123 UTSW 17 37796102 missense probably damaging 1.00
R1288:Olfr123 UTSW 17 37795693 missense probably damaging 0.98
R1897:Olfr123 UTSW 17 37796184 missense probably benign 0.22
R3751:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3753:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3780:Olfr123 UTSW 17 37796004 missense probably damaging 1.00
R3947:Olfr123 UTSW 17 37796115 missense probably benign
R5987:Olfr123 UTSW 17 37796357 missense probably benign
R6369:Olfr123 UTSW 17 37795496 missense probably benign 0.02
R6891:Olfr123 UTSW 17 37795504 missense probably benign
R7320:Olfr123 UTSW 17 37796357 missense probably benign
R7997:Olfr123 UTSW 17 37796162 nonsense probably null
R8153:Olfr123 UTSW 17 37795476 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTTGTCTACACCAGGTGACG -3'
(R):5'- TGGAGAGGTTTGCAGACAGC -3'

Sequencing Primer
(F):5'- CCAGGTGACGGGGATGATC -3'
(R):5'- TAGCGATCGAAAGCCATTACTG -3'
Posted On2017-02-28